+Advanced Search
Article Contents

Citation:

cDNA cloning of four Hsp genes from Agarophyton vermiculophyllum and transcription analysis in diferent phases

  • Corresponding author: Di Xu, dixu@ouc.edu.cn
  • Received Date: 2019-12-26
    Accepted Date: 2020-04-17
    Published online: 2020-06-22
  • Agarophyton vermiculophyllum is an agarophytic red alga originating from Northeast Asia that successfully spread to Europe and North America in the last 20 years. In this study, three hsp70 genes (hsp70-1, hsp70-2, and hsp70-3) and one hsp90 gene were cloned, and real-time reverse transcription polymerase chain reaction (RT-qPCR) was used to measure their transcriptional levels in three kinds of thalli (tetrasporophytes, and male/female gametophytes) belonging to diploid or haploid phases in the life cycle of A. vermiculophyllum. The results show that the three Hsp70s in A. vermiculophyllum clustered into three different groups, and the locations of the putative Hsp70-1, Hsp70-2, and Hsp70-3 were in the cytoplasm, endoplasmic reticulum and chloroplast, respectively, according to their sequences. Beside on the same research, the putative Hsp90 was supposed to have a cytoplasmic location. The RT-qPCR results show that the three hsp70 genes were highly upregulated in gametophytes as compared to tetrasporophytes but the transcriptional level of hsp90 did not show such a significant increase. The chloroplast hsp70-3 exhibited the highest upregulation and the transcriptional level increased more than 570 fold in female gametophytes, and 17 fold in male gametophytes, compared with tetrasporophytes. Therefore, cpHsp70-3 might act more like a chaperon molecule involved in haploid development under natural condition, while Hsp70-1 and Hsp70-2 were more active in stress resistance.
  • 加载中
  • Bellorin AM, Oliveira MC, Oliveira EC (2004) Gracilaria vermiculophylla: a western Pacific species of Gracilariaceae (Rhodophyta) first recorded from the eastern Pacific. Phycol Res 52:69-79 doi: 10.1111/j.1440-1835.2004.tb00317.x
    Boston RS, Viitanen PV, Vierling E (1996) Molecular chaperones and protein folding in plants. Plant Mol Biol 32:191-222 doi: 10.1007/BF00039383
    Boorstein WR, Ziegelhoffer T, Craig EA (1994) Molecular evolution of the Hsp70 multigene family. J Mol Evol 38:1-17 
    Brocchieri L, Conway de Macario E, Macario AJL (2008) Hsp70 genes in the human genome: conservation and differentiation patterns predict a wide array of overlapping and specialized functions. BMC Evol Biol 8:19 doi: 10.1186/1471-2148-8-19
    Bukau B, Horwich AL (1998) The Hsp70 and Hsp60 chaperone machines. Cell 92:351-366 doi: 10.1016/S0092-8674(00)80928-9
    Chen P, Shao HB, Xu D (2011) Cloning and characterization of a female gametophyte specific gene in Gracilaria lemaneiformis (Gracilariales, Rhodophyte). Afr J Microbiol Res 5:2590-2595 doi: 10.5897/AJMR11.133
    Cheng Q, Hallmann A, Edwards L, Miller SM (2006) Characterization of a heat shock-inducible hsp70 gene of the green alga Volvox carteri. Gene 371:112-120 doi: 10.1016/j.gene.2005.11.026
    Daugaard M, Rohde M, Jäättelä M (2007) The heat shock protein 70 family: Highly homologous proteins with overlapping and distinct functions. FEBS Lett 581:3702-3710 doi: 10.1016/j.febslet.2007.05.039
    Demand J, Luders J, Hohfeld J (1998) The carboxy-terminal domain of Hsc70 provides binding sites for a distinct set of chaperone cofactors. Mol Cell Biol 18:2023-2028 doi: 10.1128/MCB.18.4.2023
    Freeman BC, Myers MP, Schumacher R, Morimoto RI (1995) Identification of a regulatory motif in Hsp70 that affects ATPase activity, substrate binding and interaction with HDJ-1. EMBO J 14:2281-2292 doi: 10.1002/j.1460-2075.1995.tb07222.x
    García-Jiménez P, Robaina R (2015) On reproduction of red algae: further research needed at the molecular level. Front Plant Sci 6:93 
    Gu YH, Zhang X, Lu N, Zang XN, Zhang XC, Li GQ (2012) Cloning and transcription analysis of hsp70-1 and hsp70-2 of Gracilaria lemaneiformis under heat shock. Aquaculture 358-359:284-291 
    Gupta RS (1995) Phylogenetic analysis of the 90 kD heat shock family of protein sequences and an examination of the relationship among animals, plants, and fungi species. Mol Biol Evol 12:1063-1067 
    Gurgel CFD, Norris JN, Schmidt WE, Le HN, Fredericq S (2018) Systematics of the Gracilariales (Rhodophyta) including new subfamilies, tribes, subgenera, and two new genera, Agarophyton gen. nov. and Crassa gen. nov. Phytotaxa 374:1-23 doi: 10.11646/phytotaxa.374.1.1
    Guy CL, Li QB (1998) The organization and evolution of the spinach stress 70 molecular chaperone gene family. Plant Cell 10:539-556 doi: 10.1105/tpc.10.4.539
    Hammann M, Wang GG, Boo SM, Aguilar-Rosas LE, Weinberger F (2016) Selection of heat-shock resistance traits during the invasion of the seaweed Gracilaria vermiculophylla. Mar Biol 163:104 doi: 10.1007/s00227-016-2881-3
    Hannch G, Santelices B (1985) Ecological differences between the isomorphic reproductive phases of two species of Iridaea (Rhodophyta; Gigartinales). Mar Ecol Prog Ser 22:291-303 doi: 10.3354/meps022291
    Hughes JS, Otto SP (1999) Ecology and the evolution of biphasic life cycles. Am Nat 154:306-320 doi: 10.1086/303241
    Krueger-Hadfield SA, Kollars NM, Byers JE, Greig TW, Hammann M, Murray DC, Murren CJ, Strand AE, Terada R, Weinberger F, Sotka EE (2016) Invasion of novel habitats uncouples haplo-diplontic life cycles. Mol Ecol 25:3801-3816 doi: 10.1111/mec.13718
    Lee YK, Kim SH, Hong CB, Chah OK, Kim GH, Lee IK (1998) Heat-shock protein 90 may be involved in differentiation of the female gametophytes in Griffithsia japonica (Ceramiales, Rhodophyta). J Phycol 34:1017-1023 doi: 10.1046/j.1529-8817.1998.341017.x
    Lewis S, Donkin ME, Depledge MH (2001) Hsp70 expression in Enteromorpha intestinalis (Chlorophyta) exposed to environmental stressors. Aquat Toxicol 51:277-291 doi: 10.1016/S0166-445X(00)00119-3
    Lindquist S, Craig EA (1988) The heat-shock proteins. Annu Rev Genet 22:631-677 doi: 10.1146/annurev.ge.22.120188.003215
    Liu YT, Sun HY, Ding Y, Zang XN, Zhang XC (2018) A novel heat shock protein from Gracilariopsis lemaneiformis: gene cloning and transcription analysis in response to heat stress. J Appl Phycol 30:3623-3631 doi: 10.1007/s10811-018-1494-2
    Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCt method. Methods 25:402-408 doi: 10.1006/meth.2001.1262
    Marble BK, Otto SP (1998) The evolution of life cycles with diploid and haploid phases. BioEssays 20:453-462 doi: 10.1002/(SICI)1521-1878(199806)20:6<453::AID-BIES3>3.0.CO;2-N
    Morimoto RI, Sarge KD, Abravaya K (1992) Transcriptional regulation of heat-shock genes-a paradigm for inducible genomic responses. J Biol Chem 267:21987-21990 
    Murpy M (2013) The Hsp70 family and cancer. Carcinogenesis 34:1181-1188 doi: 10.1093/carcin/bgt111
    Ritossa F (1962) A new puffing pattern induced by temperature shock and DNP in Drosophila. Experientia 18:571-573 doi: 10.1007/BF02172188
    Saunders GW (2009) Routine DNA barcoding of Canadian Gracilariales (Rhodophyta) reveals the invasive species Gracilaria vermiculophylla in British Columbia. Mol Ecol Res 9:140-150 
    Schroda M, Vallon O, Wollman FA, Beck CF (1999) A chloroplast-targeted heat shock protein 70 (Hsp70) contributes to the photoprotection and repair of photosystem Ⅱ during and after photoinhibition. Plant Cell 11:1165-1178 doi: 10.1105/tpc.11.6.1165
    Sfriso A, Maistro S, Andreoli C, Moro I (2010) First record of Gracilaria vermiculophylla (Gracilariales, Rhodophyta) in the Po delta lagoons, Mediterranean Sea (Italy). J Phycol 46:1024-1027 doi: 10.1111/j.1529-8817.2010.00893.x
    Su PH, Li HM (2008) Arabidopsis stromal 70-kD heat shock proteins are essential for plant development and important for thermotolerance of germinating seeds. Plant Physiol 146:1231-1241 doi: 10.1104/pp.107.114496
    Sung DY, Kaplan F, Guy CL (2001) Plant Hsp70 molecular chaperones: protein structure, gene family, expression and function. Physiol Plant 113:443-451 doi: 10.1034/j.1399-3054.2001.1130402.x
    Terasawa K, Minami M, Minami Y (2005) Constantly updated knowledge of Hsp90. J Biochem 137:443-447 doi: 10.1093/jb/mvi056
    Thornber CS, Gaines SD (2004) Population demographics in species with biphasic life cycles. Ecology 85:1661-1674 doi: 10.1890/02-4101
    Vieira VMNCS, Ehgelen AH, Huanel OR, Guillemin M-L (2018a) Differentiation of haploid and diploid fertilities in Gracilaria chilensis affect ploidy ratio. BMC Evol Biol 18:183 doi: 10.1186/s12862-018-1287-x
    Vieira VMNCS, Ehgelen AH, Huanel OR, Guillemin M-L (2018b) Haploid females in the isomorphic biphasic life-cycle of Gracilaria chilensis excel in survival. BMC Evol Biol 18:174 doi: 10.1186/s12862-018-1285-z
    Weinberger F, Buchholz B, Karez R, Wahl M (2008) The invasive red alga Gracilaria vermiculophylla in the Baltic Sea: adaptation to brackish water may compensate for light limitation. Aquat Biol 3:251-264 doi: 10.3354/ab00083
    Yabe N, Takahashi T, Komeda Y (1994) Analysis of tissue specific expression of Arabidopsis thaliana hsp90-family gene HSP81. Plant Cell Physiol 35:1207-1219 doi: 10.1093/oxfordjournals.pcp.a078715
    Yokthongwattana K, Chrost B, Behrman S, Casper-Lindley C, Melis A (2001) Photosystem Ⅱ damage and repair cycle in the green alga Dunaliella salina: involvement of a chloroplast-localized Hsp70. Plant Cell Physiol 42:1389-1397 doi: 10.1093/pcp/pce179
    Zhang HN, Li W, Li JJ, Fu WD, Yao JT, Duan DL (2012) Characterization and expression analysis of hsp70 gene from Ulva prolifera J. Agardh (Chlorophycophyta, Chlorophyceae). Mar Genom 5:53-58 
    Zhou W, Sui ZH, Wang JG, Hu YY, Kang KH, Kim HB, Niaz Z (2016) Mass cultivation of economically important red alga Gracilariopsis lemaneiformis (Gracilariaceae, Rhodophyta) from tetraspores and carpospores. Aquaculture 460:25-31 doi: 10.1016/j.aquaculture.2016.03.052
  • 加载中
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Figures(2) / Tables(4)

Article Metrics

Article views(21) PDF downloads(0) Cited by()

Related
Proportional views

cDNA cloning of four Hsp genes from Agarophyton vermiculophyllum and transcription analysis in diferent phases

    Corresponding author: Di Xu, dixu@ouc.edu.cn
  • 1. The Key Laboratory of Marine Genetics and Breeding, Ministry of Education, College of Marine Life Sciences, Ocean University of China, Qingdao 266003, China

Abstract: Agarophyton vermiculophyllum is an agarophytic red alga originating from Northeast Asia that successfully spread to Europe and North America in the last 20 years. In this study, three hsp70 genes (hsp70-1, hsp70-2, and hsp70-3) and one hsp90 gene were cloned, and real-time reverse transcription polymerase chain reaction (RT-qPCR) was used to measure their transcriptional levels in three kinds of thalli (tetrasporophytes, and male/female gametophytes) belonging to diploid or haploid phases in the life cycle of A. vermiculophyllum. The results show that the three Hsp70s in A. vermiculophyllum clustered into three different groups, and the locations of the putative Hsp70-1, Hsp70-2, and Hsp70-3 were in the cytoplasm, endoplasmic reticulum and chloroplast, respectively, according to their sequences. Beside on the same research, the putative Hsp90 was supposed to have a cytoplasmic location. The RT-qPCR results show that the three hsp70 genes were highly upregulated in gametophytes as compared to tetrasporophytes but the transcriptional level of hsp90 did not show such a significant increase. The chloroplast hsp70-3 exhibited the highest upregulation and the transcriptional level increased more than 570 fold in female gametophytes, and 17 fold in male gametophytes, compared with tetrasporophytes. Therefore, cpHsp70-3 might act more like a chaperon molecule involved in haploid development under natural condition, while Hsp70-1 and Hsp70-2 were more active in stress resistance.

    HTML

Introduction
  • The agarophytic red alga Agarophyton vermiculophyllum (Ohmi) (Gurgel et al. 2018) is originally distributed in Northeast Asia but successfully spread to Europe and North America in the last 20 years (Bellorin et al. 2004; Hammann et al. 2016; Saunders 2009; Sfriso et al. 2010; Weinberger et al. 2008). The life cycle of A. vermiculophyllum is typical for an organism within the class Florideophyceae and is composed of one haploid gametophytic phase (male/female) and two diploid sporophytic phases, namely tetrasporophyte and carposporophyte. The thalli of the gametophyte and tetrasporophyte are isomorphic, while the carposporophytic stage is small and grows on the branches of the female gametophyte.

    In macroalgae, haploid-diploid shift during life-cycles is very common and persistent in their evolutionary history but the reason behind it is complex. Adaptive benefits could be an explanation (Hughes and Otto 1999; Marble and Otto 1998). For example, when invading new habitats, populations of A. vermiculophyllum are overwhelmingly dominated by diploid thalli, since the diploids having some functional advantages (Krueger-Hadfield et al. 2016). For Gracilariopsis lemaneiformis sporelings, it was also shown that the average growth rate of diploid tetrasporophytes was significantly higher than that of haploid gametophytes (Zhou et al. 2016). But what else would isomorphic biphasic algae gain from the ploidy differentiation except for the unbalanced ploidy rate in the field (Hannch and Santelices 1985; Thornber and Gaines 2004)? Reports of a survival advantage of haploids over diploids, and a fertility advantage of diploids over haploids, for Gracilaria chilensis may answer this question and it was suggested that survival and fertility differentiation support the evolution and prevalence of biphasic life-cycles (Vieira et al. 2018a, b). However, our knowledge about the endogenous molecular machinery responsible for the effective control of sexual reproduction and haploid-diploid shifts during life cycles of red algae lags far behind that of higher plants (García-Jiménez and Robaina 2015).

    Heat-shock proteins (Hsps) are ubiquitous proteins found in all studied organisms and were first described in relation to heat shock in Drosophila (Ritossa 1962). They were later shown to be induced by a wide variety of stressors, including exposure to cold, UV light, wounding, tissue remodeling, or biotic stress (Boston et al. 1996; Lindquist and Craig 1988). In seaweeds, genes encoding Hsp have been cloned and used to monitor their expression under different types of stress, such as UV light, high temperature, or high salinity (Cheng et al. 2006; Gu et al. 2012; Lewis et al. 2001; Liu et al. 2018; Zhang et al. 2012). As chaperon molecules, Hsps can also help cells to maintain normal cellular protein homeostasis by regulating the correct folding of newly synthesized peptides, as well as the transport and degradation of mature proteins (Morimoto et al. 1992). Some reports have noted the relationship between Hsps and plant development. For example, the expression of gene hsp81 (belonging to the Hsp90 family) was detected in pollen, but not in the ovule, of Arabidopsis thaliana (Yabe et al. 1994). By differential screening of the cDNA library from a mixed population of female and male gametophytes of the red alga Griffithsia japonica, it was suggested that hsp90 was active during the development of female gametophytes (Lee et al. 1998).

    For A. vermiculophyllum, it was reported that the invasive populations, which were mainly tetrasporophytes (Krueger-Hadfield et al. 2016), expressed cytoplasmic protein Hsp70 at significantly higher levels than Chinese and Korean native populations which consist of tetrasporophytes and gametophytes in equal parts (Hammann et al. 2016). These findings suggest a relationship between ploidy and Hsp70 for A. vermiculophyllum, but what would be the situation if multiple hsp70 were considered? In this study, three hsp70 genes and one hsp90 gene were cloned for A. vermiculophyllum. Real-time reverse transcription polymerase chain reaction (RT-qPCR) was used to check their different transcriptional levels in both haploid and diploid fertile stages under normal condition without stress. The possible location and related function of these putative Hsps in different phases are discussed.

Results

    Whole length cDNA cloning and sequence analysis for the three hsp70 genes of A. vermiculophyllum

  • The complete CDS of hsp70-1 contained 1977 nucleotides with the initiation codon ATG and the termination codon TAA included (Supplementary Fig. S1). The sequence was deposited in GenBank under accession number MH 551265.1. This sequence encoded a deduced protein, Hsp70-1, containing 658 amino acid residues with a calculated molecular weight of 71.66 kDa and theoretical pI of 4.88. According to the results from the websites http://prosite.expasy.org and http://hits.isb-sib.ch/cgi-bin/PFSCAN, this protein was found to have three typical Hsp70 family signature sequences, including IDLGTTYS, IFDLGGGTFDVSLL, and IVLVGGSTRIPKVQS (Bukau and Horwich 1998; Liu et al. 2018). In addition to these, a short sequence SEVD (similar to EEVD) was also found at the 3' end of Hsp70-1, which is regarded as a characteristic cytoplasmic tag for Hsp70 (Boorstein et al. 1994; Freeman et al. 1995).

    The complete CDS of hsp70-2 consisted of 1992 nucleotides with the initiation codon ATG and the termination codon TAG included (Supplementary Fig. S2). The sequence was deposited in GenBank under accession number MH 551266.1. This sequence encoded a deduced protein, Hsp70-2, that contained 663 amino acid residues with a calculated molecular weight of 72.46 kDa and a pI of 4.68. The three typical Hsp70 family signature sequences, IDLGTTYS, VFDLGGGTFDVTLL, and VVLVGGSTRIPKVQQ, were also found here. A short sequence HEEL (similar to HDEL) was found at the 3' end Hsp70-2 which functions as an endoplasmic reticulum targeting sequence in Hsp70 (Demand et al. 1998).

    The complete CDS of hsp70-3 consisted of 1866 nucleotides with the initiation codon ATG and the termination codon TAA included (Supplementary Fig. S3). The sequence was deposited in GenBank under accession number MH 551267.2. This sequence encoded a deduced protein, Hsp70-3, containing 621 amino acid residues with a calculated molecular weight of 68.21 kDa and a pI of 4.79. Similar to Hsp70-1 and Hsp70-2, three typical Hsp70 family signature sequences were also found in Hsp70-3 with slight modification to IDLGTTNS, ILVFDLGGGTFDVSIL, and IVLVGGSTRIPAIQ -Q.

    Although the similarity of nucleic acid between each of the three hsp70 genes cloned from A. vermiculophyllum compared to their equivalent genes in G. lemaneiformis was not higher, at 91% (Hsp70-1), 80% (Hsp70-2), and 85% (Hsp70-3), the similarity of the amino acid sequences between each of the three deduced Hsp70 proteins was much higher and showed the conserved nature of Hsp proteins, at 98% (Hsp70-1), 90% (Hsp70-2), and 92% (Hsp70-3), respectively.

  • Phylogenetic tree for Hsp70

  • The phylogenetic tree in Fig. 1 was drawn according to the alignment results of the deduced Hsp70 protein sequences from A. vermiculophyllum and their related protein sequences acquired from the NCBI database. It is shown from the tree that the three Hsp70s in A. vermiculophyllum were separated into three different clusters.

    Figure 1.  NJ tree for three members of Hsp70 cloned in A. vermiculophyllum and their related proteins (the three colors indicate the three Hsp70 clusters)

  • Whole length cDNA cloning and sequence analysis for the hsp90 genes of A. vermiculophyllum

  • The complete CDS of hsp90 consisted of 2193 nucleotides with the initiation codon ATG and the termination codon TAA included (Supplementary Fig. S4). The sequence was deposited in GenBank under accession number MH 551268.2. This sequence encoded a deduced protein, Hsp90, containing 730 amino acid residues with a calculated molecular weight of 83.3 kDa and a pI of 4.59. Five segments of typical Hsp90 family signature sequences, YSNKEIFLRELISNASDALNKVR, LGMIANSGTK, MIGQFGVGFYSSYLVA, IKLYVKRVFIM, and KGVVDSEDLPLNLSREM were found in this protein (Gutpa 1995). At the C-terminus, MEEVD is a characteristic cytoplasmic tag for Hsp90 (Terasawa et al. 2005). According to Blastp from the U.S. National Center for Biotechnology Information (NCBI), the similarity between Hsp90 from A. vermiculophyllum and Gracilariopsis chorda, currently the most closely related sequence that could be found on the website, was 99% with only one amino acid difference.

  • Quantitative analysis of mRNA transcription of hsp genes among the three different thalli of A. vermiculophyllum

  • The relative transcriptional levels of hsp70-1, -2, -3, and hsp90 genes were estimated using RT-qPCR, and the results are shown in Fig. 2, where RQ represents 2-ΔΔCt using the relative transcriptional value for tetrasporophytes as the control for each gene. Therefore, in each diagram, the logRQ for tetrasporophytes is 0, and the positive values in male and female gametophyte indicate the upregulated gene transcription.

    Figure 2.  Relative transcriptional levels of four hsp genes in different thalli of A. vermiculophyllum. a-d Relative transcriptional levels of hsp70-1, hsp70-2, hsp70-3 and hsp90 genes, respectively. The relative transcriptional value for tetrasporophytes was set as the control for each gene

    The qRT-PCR results showed that all three hsp70 genes were highly upregulated in gametophytes compared to their transcriptional levels in tetrasporophytes, but the hsp90 gene showed little enhancement. Among the three hsp70 genes, hsp70-3 exhibited the highest upregulation in gametophytes as compared to the tetrasporophyte: the transcriptional level increased more than 570 fold in female gametophytes and 17 fold in male gametophytes. For hsp70-1 and hsp70-2, the transcriptional level increased more than 6 fold and 35 fold in female gametophytes, respectively, but only approximately 1.5 and 4 fold, respectively, in male gametophytes.

Discussion
  • Hsp70 is one of the most conserved proteins (Lindquist and Craig 1988) and all eukaryotes have multiple hsp70 gene products that differ from each other in gene structure, subcellular location, and expression level (Brocchieri et al. 2008; Murpy 2013). In the present study, the sequence similarities of the three Hsp70s cloned from A. vermiculophyllum were all at least 90% higher than their corresponding proteins in Gracilariopsis lemaneiformis. However, the similarities among them were low, i.e., 63% (Hsp70-1 vs. Hsp70-2), 48% (Hsp70-1 vs. Hsp70-3), and 49% (Hsp70-2 vs. Hsp70-3). This indicates both their conserved nature and functional divergence.

    Previous studies have shown that different Hsp70 paralogs have both overlapping and diverse functions (Boorstein et al. 1994; Daugaard et al. 2007). The divergent C-terminal SBDs (substrate-binding domains) are necessary for certain co-chaperone interactions and probably define their distinctive function (Brocchieri et al. 2008; Demand et al. 1998; Sung et al. 2001). For example, cytosolic eukaryotic Hsp70s possess GGMP repeats and the EEVD motif at the carboxyl terminus, whereas other Hsp70 family members lack such structural elements (Boorstein et al. 1994; Freeman et al. 1995). It has been shown that in photosynthetic eukaryotes: (1) the Hsp70s are located in four different cell compartments: the cytoplasm, mitochondria, endoplasmic reticulum (ER), and chloroplast (Bukau and Horwich 1998; Sung et al. 2001), and; (2) the most common motif for the cytosolic is EEVD, for the endoplasmic reticulum (ER) is HDEL, for the mitochondrion is PEAEYEEAKK and for the plastid is PEGDVIDADFTDSK (Guy and Li 1998). In the present study, the phylogenetic tree shows that the three Hsp70s cloned from A. vermiculophyllum were clustered into three different groups (Fig. 1). Hsp70-1 and Hsp70-2 are associated with cytoplasmic and endoplasmic reticulum locations, respectively, since each of them had the typical localization tag (motif EEVD or HDEL) at their C-terminus. For Hsp70-3 (AX191579.1), although the sequence of the C-terminus motif was not perfectly matched with the plastid motif sequence mentioned above (Table 1), the sequence structures for all the quoted Gracilariaceae species in this cluster were the same. Some of the sequences were explicitly acquired from chloroplast genome research, such as YP_063608.1 from G. tenuistipitata and YP_009509315.1 from A. vermiculophyllum. Therefore, it can be inferred that the Hsp70-3 in this cluster is associated with a chloroplast location. It has been shown that there are two putative cpHsp70s (chloroplast Hsp70s) in fully sequenced genomes of land plants, such as Arabidopsis and rice, but the green alga Chlamydomonas only harbors a single cpHsp70 (Su and Li 2008). It is currently unknown whether this is also true for red algae.

    Gracilariaceae species The sequence of C-terminus
    Gracilariopsis lemaneiformis heat shock protein 70-3 ALJ33148.1 KQQETDNTDTDSVID-------TNSKEA
    Gracilaria tenuistipitata heat shock protein 70 (chloroplast) YP_063608.1 TQQDNSKTEDGSVID-------TNSKEA
    Agarophyton vermiculophyllum Hsp70-type chaperone (chloroplast) YP_009509315.1 TQEENKKTEDDSVID-------TKSKEA
    Agarophyton vermiculophyllum heat shock protein 70-3 AX191579.1 QLKKNKKTEDDSVID-------TKSKGS
    Chloroplast C-terminal motif PEGDVID ADF TDSK

    Table 1.  Sequence alignment of the C-terminus of Hsp70-3

    These three hsp70 genes (hsp70-1, hsp70-2 and hsp70-3) were previously cloned and tested for their transcriptional level under heat shock in Gracilariopsis lemaneiformis (Gu et al. 2012; Liu et al. 2018) and the results indicated that in the wild type Hsp70-1 was the most active Hsp70 after the heat shock, because its transcriptional level increased dramatically. On the other hand, the transcriptional levels for hsp70-2 and especially for hsp70-3 were low, so it is supposed that under heat shock, Hsp70-2 and Hsp70-3 may play only a supporting role. Hsp70-3 is probably employed more actively in reaction to stresses other than heat. In the current study for A. vermiculophyllum as mentioned above, the transcriptional levels of all three hsp70 genes were highly upregulated in gametophytes as compared to tetrasporophytes, and the highest increase was the hsp70-3 in gametophytes, especially in female gametophytes. Chen et al. (2011) have previously shown that hsp70-3 is one of the differentially expressed gene clones in the female gametophytic SSH (suppression subtractive hybridization) library constructed between matured female and male gametophytes of G. lemaneiformis. Furthermore, it was reported that in the green algae Chlamydomonas and Dunaliella, chloroplast stromal Hsp70B has a functional relationship with photosynthesis (Schroda et al. 1999; Yokthongwattana et al. 2001), and in Arabidopsis, cpHsp70 has been shown to be essential in plant development with knockout mutants having variegated malformed cotyledons and roots (Su and Li 2008).

    All these results suggest that Hsp70-3 is located in the chloroplast and, in A. vermiculophyllum, plays an important role as a chaperon molecule in the development of haploid gametophytes, especially in the female gametophyte.

    It has been previously reported that the cytoplasmic protein Hsp70 is more highly expressed in invasive populations (mainly tetrasporophytes) of A. vermiculophyllum than in native mixed-ploidy populations not only after, but also before, heat shock (Hammann et al. 2016; Krueger-Hadfield et al. 2016). There are, however, at least two possible explanations for the difference between these findings and those of the present study. Firstly, the methods used differed in the different studies. In Hammann et al. (2016), the Hsp70 content was checked using Western Blot, while here the quantities of transcribed hsp70 genes were detected by RT-qPCR. The correlation of transcription level of a gene to its protein level is not always consistent. Secondly, the environmental conditions of the algae were different. The invasive population of A. vermiculophyllum were actually under stress due to the unfamiliar conditions of their new environment and that may induce the expression of cytoplasmic Hsp70-1. But our experiments were focused on the activities of different hsp genes in different ploidy plants of native specimens without stress, so the stress-resistant trait was not the primary one induced.

    In contrast to Hsp-70, it has previously been suggested that hsp90 is active during the development of female gametophytes in Griffithsia japonica (Lee et al. 1998). In the present study, however, we did not find significant differences for the transcriptional levels of hsp90 among tetrasporaphytes and male/female gametophytes.

    In conclusion, in A. vermiculophyllum and probably other related red algae, cytoplasmic Hsp70-1 and ER Hsp70-2 might be more active in heat resistance, and Hsp70-3, as the chloroplast Hsp70 (cpHsp70), might participate as a chaperon molecule important for haploid development. Further studies are needed to understand the precise function(s) of cpHsp70 in A. vermiculophyllum.

Materials and methods

    Collection and temporary cultivation of A. vermiculophyllum

  • Wild thalli of A. vermiculophyllum were collected from Fushan Bay, Qingdao, China (36.0° N, 120.2° E) during their fertile period. Three types of mature thalli—tetrasporophytes (diploid), female and male gametophytes (haploid)—were separated and thoroughly rinsed with sterilized seawater and cultured in seawater supplemented with 100 μmol/L NaNO3 and 10 μmol/L NaH2PO4 (final concentration) at 20 ℃ with 50-60 μmol photons/m-2s-1 for a light/dark period of 12 h:12 h for 1-2 days.

  • Total RNA extraction and cDNA synthesis

  • Total RNAs were extracted from 200 mg fresh thalli for each sample, using the GeneJET Plant RNA Purification Kit (Thermo Fisher Scientific, USA). The extracted RNAs were quantified using a spectrophotometer and verified by running samples on 1.0% agarose gels. To remove the remaining genomic DNA, total RNAs were treated with DNaseI (30 U) for 15 min at 37 ℃. Then 1 μg total RNAs were subject to cDNA synthesis using SuperScriptTM Ⅱ reverse transcription (RT)-PCR kit (TaKaRa, Japan) in 25 μl volume according to instruction manual, using the Anchored Oligo(dT)18 Primer. The first strands of cDNA obtained were used for partial cDNA fragment cloning and real-time PCR. For 3' and 5' RACE, the first strands of cDNA were obtained using 3'CDS primer (Table 3) according to SMARTer RACE 5'/3' Kit (Clontech, USA).

    Function Name of the primers Primer sequences (5′–3′)
    3′ RACE
     Antisense 3′ CDS primer AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTVN
     Sense hsp70-1 3′ GSP 1 CTTCTACTCATCCGTCACTCGTGCCAA
    hsp70-1 3′ GSP 2 GAACATCAACCCGGACGAGGCTGTG
    hsp70-1 3′ GSP 3 GCCTCGTCCGGGTTGATGTTCTTGC
    hsp70-2 3′ GSP 1 TGATGAAGCTCTTCAAGCGCAAGTACGGC
    hsp70-2 3′ GSP 2 CGAGGTTGTGCTAGTCGGCGGTTC
    hsp70-2 3′ GSP 3 GACATGTCGGCGTCCTTGAGAACCTTCT
    hsp70-3 3′ GSP 1 TATTACTTCTACCGATACAGGCCCCAA
    hsp70-3 3′ GSP 2 GTGTTAATCCTGATGAAGTAGTTGCAATT
    hsp70-3 3′ GSP 3 CAGGGAGAAAGAGAGTTTACTAAAGACA
    hsp90 3′ GSP 1 CAGCCGTGAGATGCTCCAGCAGAATAAGA
    hsp90 3′ GSP 2 CGTATGAAGGAGGGTCAGAAGAACATCTACTAC
    hsp90 3′ GSP 3 GCGCGAAGAGGAGAAGAAGGCTTGTG
    5′ RACE
     Sense 5′ CDS primer a TAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT
    5′ CDS primer b CTAATACGACTCACTATAGGGC
     Antisense hsp70-1 5′ GSP 1 CAATGGTGAGGAGGGAGACATCGAAAGTTC
    hsp70-1 5′ GSP 2 TCTCCCTCCTCACCATTGAAGACGGTAT
    hsp70-1 5′ GSP 3 CTTCTACTCATCCGTCACTCGTGCCAA
    hsp70-2 5′ GSP 1 GACAGCGTTCTTGACTTCCTTGCCGAG
    hsp70-2 5′ GSP 2 GGAGTACCTCGGCAAGGAAGTCAAGAAC
    hsp70-2 5′ GSP 3 TGATGAAGCTCTTCAAGCGCAAGTACGGC
    hsp70-3 5′ GSP 1 CCATATGATAAAGATGCTGCTGTTGGTTC
    hsp70-3 5′ GSP 2 TGAACCAACAGCAGCATCTTTATCATATGG
    hsp70-3 5′ GSP 3 TATTACTTCTACAGATACAGGCCCTAAACA
    hsp90 5′ GSP 1 CCTCCTCAGTGTCCTCCAACTCCATAC
    hsp90 5′ GSP 2 CTGGTCAGCTCATCAGTGCTCTTAGTGG
    hsp90 5′ GSP 3 GGCAAATCCTCAGAGTCGACAACACCC

    Table 3.  Primers used in the 3' and 5' RACE for whole CDS sequences of Hsp genes

  • Whole length cDNA cloning of hsp genes for A. vermiculophyllum

    Partial cDNA fragment cloning of hsp genes
  • Three hsp70 genes, i.e., hsp70-1, hsp70-2, and hsp70-3, were previously cloned from Gracilariopsis lemaneiformis, which is a red algal species in a closely related genus to Gracilaria (Gu et al. 2012; Liu et al. 2018). Therefore, we used these three genes and their related sequences as the templates to design the degenerate primers for cloning the partial cDNA fragment of each hsp70 gene from A. vermiculophyllum. The coding sequences (CDSs) used as templates were: G. lemaneiformis (KR534897.1), Chondrus crispus (XM_005712356.1), Pyropia haitanensis (KF715267.1), and Pyropia yezoensis (KF574043.1) for cloning hsp70-1; Gracilariopsis lemaneiformis (KR534898.1), Chondrus crispus (XM_005718442.1), Pyropia haitanensis (KF715271.1), and Galdieria sulphuraria (XM_005707399.1) for cloning hsp70-2, Gracilariopsis lemaneiformis (KR534899.1), Gracilaria salicornia (NC_023785.1), Gracilaria tenuistipitata (NC_006137.1), and Gelidium elegans (NC_029858.1) for cloning hsp70-3.

    The degenerate primers for cloning the partial cDNA fragment of hsp90 from A. vermiculophyllum were designed following the same procedure for hsp70 cloning. The three complete CDSs of hsp90 gene used were Chondrus crispus (XM_005715072.1), Pyropia yezoensis (GU301885.1), and Pyropia haitanensis (KF732652.1).

    All the designed degenerate primers mentioned above are shown in Table 2. Nest PCR was utilized to enhance the specificity of the products.

    Name of the primers Primer sequences (5′–3′)
    hsp70-1 sense 1 CTACTCDTGYGTSGGYRTGG
    hsp70-1 sense 2 GTSCCSGCCTACTTYAAYGACTC
    hsp70-1 sense 3 GCTGGTGAYACTCAYYTKGGDGG
    hsp70-1 antisense 3 GTCATVACSRCACCRGCVGTCTC
    hsp70-1 antisense 2 TGGTTGTCRGMGTAVGTVGARAAGA
    hsp70-1 antisense 1 CCTCYTCCTCAGCCTTGWAYTTCTC
    hsp70-2 sense 1 CGCCAGGCBACWAAGGAYGC
    hsp70-2 sense 2 GGWGGWGARGACTTTGACCAGCG
    hsp70-2 sense 3 CTCATTGGCGACGCCGCAAAGAAC
    hsp70-2 antisense 3 GATCTTGSTCATSACACCBCCAACMGT
    hsp70-2 antisense 2 CCCTTGTCATTGGTGRTAGTGATGRTG
    hsp70-2 antisense 1 ATKCCAYTGAGRTCRAAYTTSCCG
    hsp70-3 sense 1 GACAAGCWGTAATKAATCCRGAAAATAC
    hsp70-3 sense 2 GCTCCTGARGAAATTTCTGCWCA
    hsp70-3 antisense 2 ATRCCATCYAATCTAAAAGTNCCRAAAC
    hsp70-3 antisense 1 GTAATWGATTGKTCTTTACCWGTTCCTTTATC
    hsp90 sense 1 GACACCAAGGTCGAAGACATCNCTGAGGATGA
    hsp90 sense 2 CAGCTCGAATTCAAGGCSATCAT
    hsp90 sense 3 GGGTGTTGTCGACTCTGAGGAT
    hsp90 antisense 3 TCCAGTRATGTAGTARATGTTCTTCTG
    hsp90 antisense 2 GCCTGCGCCTTCATGATRCGYTCCATGT
    hsp90 antisense 1 ACTTCMTCCATGTTRGAGGCAGCRG

    Table 2.  Degenerate primers designed for cloning the partial cDNA fragments of Hsp genes from A. vermiculophyllum

    The PCR for each reaction was performed with 20 μl of a mixture containing 2 μl of 10 × buffer, 2.0 mmol/L MgCl2, 0.25 mmol/L of each dNTP, 0.25 U of TaqDNA polymerase (TaKaRa, Japan) and 1 μmol/L of each primer. PCR products as the templates for next round of Nest PCR reaction needed to be diluted 50-fold. The final PCR products were purified and inserted into the pMD18-T vector (TaKaRa, Japan) which was used to transform Escherichia coli DH5α competent cells. Products were then sequenced by Shanghai Invitrogen.

  • 3' and 5' RACE for Hsp genes
  • Nest PCR was applied in the 3' and 5' RACE to obtain the whole CDS sequences of Hsp genes. The first strands of cDNA obtained with SMARTer RACE 5'/3' Kit (Clontech, USA) was used as the template for RACE. The 3' CDS primer and 5' CDS primers contained in the kit and the designed GSPs (gene specific primers) are listed in Table 3. The PCR reaction process was used following the manufacturer's instructions.

    The phylogenetic tree based on the results of multiple alignments of amino acid sequences among the deduced Hsp70 with other related proteins were constructed using MEGA 5.22.

  • Real-time PCR analysis of the four hsp genes in different phases
  • Real-time PCR analysis of the mRNA relative transcription levels were performed using RealMaster Mix (SYBR Green) (TIANGEN, China) and an ABI 7500 Fast real-time PCR platform. The real-time PCR amplification profile was 95 ℃ for 30 s and then 40 cycles of 95 ℃ for 5 s, 54 ℃ for 20 s, and 72 ℃ for 30 s using the designed primers listed in Table 4. After amplification, the melting curve was generated with a ramp speed of 0.5 ℃ every cycle from 60 to 95 ℃ by heating 30 s each cycle. For each gene, a standard amplification curve was constructed with five serial dilution points (in steps of tenfold) of cDNA. All reactions were carried out in three technical replicates and each group also had three replicates using different individual plants. The data were collected at the end of each extension step. The relative transcriptions of genes for each treatment group were analyzed by the 2-ΔΔCt method (Livak and Schmittgen 2001). The housekeeping gene CoI (cytochrome oxidase) was used as the internal reference genes.

    Gene Primer sequence (5′–3′) (sense/antisense)
    hsp70-1 CTTCTACTCATCCGTCACTCGTGCCAA
    TCTCCCTCCTCACCATTGAAGACGGTAT
    hsp70-2 CGAGGTTGTGCTAGTCGGCGGTTC
    GACAGCGTTCTTGACTTCCTTGCCGAG
    hsp70-3 TATTACTTCTACAGATACAGGCCCTAAACA
    TGAACCAACAGCAGCATCTTTATCATATGG
    hsp90 TGCTGGAGCATCTCACGG
    CAGCTCGAATTCAAGGCCAT
    Rbc-L AGTAACTCCTGTTGCTTC
    GTAGAGGACCACATGTTT
    CoI CTCGATCCAAAGCCATT
    CAGCCAACAGTAACAGAAAA

    Table 4.  Primer sequences of candidate internal control genes and hsp genes

Acknowledgements
  • This research was supported by the National Natural Science Foundation of China (Grant nos. 41476111 and 31372529).

Author contributions
  • Conceptualization: XP and DX; data curation: WZ; formal analysis: XP, HY and ZS; funding acquisition: DX; investigation: XC; methodology: XP and DX; project administration: XP; resources: WZ, XC and ZS; software: WZ, HY and XC; validation: DX; visualization: ZS and HY; writing-original draft: XP; writing-review and editing: XP and DX.

Compliance with ethical standards

    Conflict of interest

  • The author declares that there is no confict of interest.

  • Animal and human rights statement

  • This article does not contain any studies with human participants or animals performed by the author.

Reference (42)

Catalog

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return