| Citation: |
Zhen Wu, Xiaohong Yang, Senjie Lin, Wai Hin Lee, Paul K. S. Lam. 2021: A Rhizobium bacterium and its population dynamics under different culture conditions of its associated toxic dinoflagellate Gambierdiscus balechii. Marine Life Science & Technology, 3(4): 542-551. DOI: 10.1007/s42995-021-00102-1
|
Algae-bacteria associations have increasingly been recognized to be important in shaping the growth of both algae and bacteria (Cole 1982). Many algae rely on vitamins produced by the bacterial community (Croft et al. 2005; Rambo et al. 2020; Tang et al. 2010). In some of these symbiotic relationships, bacteria provide algae with major nutrients such as phosphorus, nitrogen (Axler et al. 1981; Bloesch et al. 1977; Golterman 1972), and growth regulators (Amin et al. 2015; Delucca and McCracken 1977; Nakanishi et al. 1996). Furthermore, bacteria can be a potential food source for mixotrophic algae (Jeong et al. 2008). In return, algae in these associations can provide organic carbon as well as nutrients for bacteria, and serve as a microhabitat for these associated microbes (Alavi et al. 2001; Anderson and Macfadyen 1976; Rambo et al. 2020).
Among the diverse types of algae-associated bacteria documented so far, Roseobacter (Sule and Belas 2013), Dinoroseobacter (Biebl et al. 2005), Marinobacter (Amin et al. 2012), Algiphilus (Gutierrez et al. 2012), and Alteromonas (Brinkmeyer et al. 2000) are the most common. Rhizobium and other Rhizobiales bacteria are important symbionts of legumes often developing nodules on plant roots, where these bacteria fix N2 and provide the resulting nitrogen compounds to support plant growth (Mitsustin and Sil'nikova 1968). Rhizobium has been found in association with marine green algae (Hodkinson and Lutzoni 2009; Kim et al. 2014a) and brown algae (Dittami et al. 2014, 2016), but never yet with dinoflagellates.
Gambierdiscus balechii is a benthic dinoflagellate that can produce ciguatoxins and have induced ciguatera fish poisoning in the Republic of Kiribati (Dai et al. 2017). As benthic epiphytic dinoflagellates, Gambierdiscus spp. are often found in association with macro-algae in environments where nutrients are low and growth can be limited in the water column (Lartigue et al. 2009). Although Gambierdiscus spp. are commonly known as photoautotrophs, they can still use the exogenous organic carbon substrates for growth (Price et al. 2016), suggesting their mixotrophic capability. Past researches have suggested that these dinoflagellates may require bacteria to maintain vigorous growth (Price et al. 2016; Rambo et al. 2020; Sakami et al. 1999). Gambierdiscus spp. have been reported to associate with Alteromonas sp. and Pseudomonas sp. (Sakami et al. 1999; Tosteson et al. 1989) but no associations with Rhizibiales bacteria have been documented. Cell wall hydrolase (CWH) is an enzyme that can hydrolyze cell walls of bacteria or algae and has been thought to play an important role in algae-bacteria associations (Cole 1982; Parisien et al. 2008). CWH documented so far is mainly peptidoglycan hydrolase, and is thus theoretically widespread in bacteria (with peptidoglycan cell wall) because it is needed during cell division, although its exact taxonomic distribution is unclear. However, some studies have shown multiple species of CWH-containing bacteria and suggested algicidal or autolysis functions. For instance, the CWH-containing Pseudoalteromonas sp. is able to degrade cell walls of Prorocentrum minutum (Kim et al. 2009) and Alteromonas sp. is able to degrade cell walls of P. donghaiense (Shi et al. 2018), whereas some other bacteria can use CWH for endolysis, exolysis, or autolysis (Vermassen et al. 2019). The encoding gene, therefore, offers a useful screening tool. In this study, from the culture of the toxic benthic dinoflagellate Gambierdiscus, we detected a CWH gene (cwh)-containing bacterium and identified it as Rhizobium rosettiformans based on molecular analyses. To examine if this Rhizobium bacterium could fix N2 and might benefit from G. balechii and in return support algal growth, we conducted cultures using different nitrogen concentrations and measurements in different algal growth phases. The results indicate that this Rhizobium possessed a chlorophyllide a reductase-encoding gene (bchX) rather than a diazotrophic nitrogenase gene (nifH); furthermore, the abundance of this bacterium increased when G. balechii growth is suboptimal due to late growth stage of nutrient limitation.
From an exponential growth culture of G. balechii, a sample was collected for bacterium isolation. Random clones were selected when colonies appeared on the marine agar plate. cwh primers were used to screen the bacterial clones. Out of these selected clones, 50% yielded positive PCR results.
The further sequencing and BLAST analyses of 16S rRNA gene (rDNA) amplicons from the cwh-positive colonies revealed Bacterium spp., Bacillus spp., Rhizobium spp., and Flavobacterium spp. The strain (we named it as GAMBA-01) that corresponded to Rhizobium 16S rDNA (NCBI accession no. MN577391) was selected for further characterization. The sequence of GAMBA-01 with a length of 1362 bp was 99.78% identical to that of Rhizobium rosettiformans strain W3, which was isolated from groundwater from Lucknow, India (Kaur et al. 2011) using the EzBioCloud server (www.ezbiocloud.net). Based on the commonly used species-delineating criterion of 16S rDNA identity (98.65% for prokaryotes; Kim et al. 2014b), GAMBA-01 was classified as Rhizobium rosettiformans. The result of phylogenetic analysis verified that this bacterial strain belonged to the same sub-cluster as other Rhizobium strains (Fig. 1). Similarly, sequencing and phylogenetic analyses of CWH from the isolated R. rosettiformans strain GAMBA-01 (NCBI accession no. MN714645) also showed that it was affiliated with R. rosettiformans (Fig. 2).
The nifH gene primers Nh21F and nifH3 (Gaby and Buckley 2012) were used to amplify the nifH gene or its homologs. The 514-bp PCR product (NCBI accession no. MN714646) was most similar (97.08% identity) to bchX of Rhizobiales bacteria, encoding chlorophyllide a reductase iron protein subunit X. bchX is a diverged homolog of nifH (Fig. 3) and functions in the bacteriochlorophyll a biosynthetic process. This identified BchX contains a conserved domain of 4Fe-4S iron-sulfur cluster binding protein that also belongs to the NifH/FrxC family. Alignments of the amino acid sequence of the isolated bchX with NifH or NifH homologs showed that the conserved residues of the 4Fe-4S iron-sulfur cluster-ligating cysteines are invariant, suggesting that these enzymes might function in similar fashions (Fig. 3).
Starting with equal cell concentrations, N-replete and N-limited groups grew similarly for the first 34 days, after which their growth curves started to diverge (Fig. 4a). Statistical analysis showed that there existed significant differences between groups after Day 34 (Fig. 4a, P < 0.05), indicating that G. balechii entered N-limited physiological conditions after 34 days. The chlorophyll a (potentially including bacteriochlorophyll a) level per G. balechii cell from both N-replete and N-limited groups increased initially but decreased overtime after reaching the peak value (Fig. 4b). In general, the chlorophyll a level was higher in the N-replete group than in the N-limited group (Fig. 4b). The highest chlorophyll a value was 0.28 ng per G. balechii cell on Day 25 in the N-replete group and 0.21 ng cell−1 in the N-limited group on Day 31. Chlorophyll a level in N-limited cultures declined rapidly after Day 31 and was significantly lower than that in the N-replete group (P < 0.05) (Fig. 4b). Because the cell growth curves of the two treatments diverged after 34 days, we only presented the cell size data after 34 days when G. balechii cells entered the N-limited physiological condition. G. balechii cell sizes were similar from Day 40 to Day 49 in the N-replete and N-limited groups but were higher in the N-limited group after 49 days with a significant difference on Day 52 and Day 55 (P < 0.05) (Fig. 4c).
We conducted qPCR to quantify copy numbers (proxy of abundance) of the 16S rDNA of our strain GAMBA-01 of R. rosettiformans normalized to per algal cell in the early (Day 40) and late (Day 61) exponential growth phases of G. balechii. Results showed that the normalized abundance of the 16S rDNA was higher in the N-limited groups during both early and late exponential growth phases than that in the N-replete cultures (Fig. 5a). The copy number difference in the late exponential phase between the N-replete and N-limited cultures was significant (P < 0.05) (Fig. 5a).
The copy numbers of the cwh on Day 40 and Day 61 in the N-replete and N-limited groups of G. balechii were also quantified and normalized to per algal cell basis. Similar to the 16S rDNA, cwh was more abundant in the N-limited group than in the N-replete group, and the difference was significant during the late exponential phase (P < 0.05) (Fig. 5b). In contrast, no significant difference in cwh copy number was detected in the N-replete group between the early and late exponential phases (Fig. 5b).
In the present study, we isolated a strain of Rhizobium bacterium from a toxic strain of G. balechii. A range of analyses, including physiological and molecular analyses, were used to identify and characterize this bacterial strain on G. balechii. As the first report of a Rhizobium bacterium associated with a dinoflagellate, the study also provides a new model for studying the dinoflagellate-bacteria associations.
Rhizobium and other Rhizobiales bacteria can fix N2 for higher plants (Fisher and Long 1992). Considering that N sources can be limited in the marine environment, particularly in tropical waters usually inhabited by Gambierdiscus species (Lartigue et al. 2009), associations of this alga with Rhizobiales bacteria are of particular interest, as their potential to fix N2 might offer advantages for the algae to thrive under the N-limited condition.
Various Rhizobiales bacteria have been documented to exist in association with dinoflagellates, including the toxic P. lima (Biebl et al. 2006), Alexandrium lusitanicum (Biebl et al. 2006), and A. minutum (Palacios et al. 2006). For example, Hoeflea phototrophica has been isolated from cultures of P. lima and A. lusitanicum (Biebl et al. 2006), and a species from the same bacterial genus (H. alexandrii) was isolated from A. minutum (Palacios et al. 2006). None of these were Rhizobium, however. The detection of Rhizobium in the G. balechii culture, along with the previous reports of Rhizobiales suggests that the association of dinoflagellates with Rhizobiales bacteria might be more widespread than currently known. Associations with Rhizobiales have also been found for the coral endosymbionts Symbiodiniaceae (LaJeunesse et al. 2018; Shoguchi et al. 2013).
Nevertheless, Rhizobiales bacteria in association with dinoflagellates did not seem to have the N2-fixing capability. In our study, the bchX gene we detected in R. rosettiformans GAMBA-01 functions in the biosynthesis of bacteriochlorophyll (AAGAARD and Sistrom 1972; Nomata et al. 2006), suggesting a photosynthetic potential of R. rosettiformans GAMBA-01. The Rhizobiales bacterium H. phototrophica isolated from the benthic dinoflagellate P. lima culture was shown to perform photosynthesis but was not able to fix N2 in the dinoflagellate culture (Biebl et al. 2006). Similarly, N2-fixing activity was not detected and nifH could not be amplified in Rhizobiales bacteria from the microbial community of Alexandrium spp. under laboratory conditions (Wiese 2012). Furthermore, a non-N2-fixing H. alexandrii was isolated from the toxic dinoflagellate A. minutum AL1V (Palacios et al. 2006). These results altogether indicate that the Rhizobiales bacteria isolated from G. balechii and other dinoflagellates are unlikely to be able to fix N2. More studies are required to elucidate if these bacteria can photosynthetically fix CO2 in dinoflagellate cultures and how much these bacteria rely on the associated dinoflagellates for organic carbon.
Similar to previous studies on other species of dinoflagellates (Li et al. 2016; Vidyarathna and Granéli 2013; Zhang et al. 2014), N limitation caused decreases in G. balechii growth rate and cell yield in the present study. Cellular chlorophyll a content, an important indicator of the photosynthetic process (Krause and Weis 1991; Platt et al. 1983), was also reduced under N-nutrient limitation. This trend might actually be more pronounced than our data showed, given that our measurements could not distinguish and remove the bacteriochlorophyll a from Rhizobium cells. Chlorophyll a content also decreased during the late exponential phase of G. balechii under both N-limited and N-replete conditions. As nutrient stress and aging have been shown to induce the production of extracellular polycarbohydrate substance (Vanucci et al. 2010; Vidyarathna and Granéli 2013), the late stationary growth stage and N-limited culture condition might create a favorable organic carbon environment for Rhizobium and other bacteria in the G. balechii cultures. Indeed, our results of qPCR analysis showed that R. rosettiformans GAMBA-01 (based on 16S rDNA and cwh) was more abundant in the N-limited cultures of G. balechii than in the N-replete cultures, especially during the late exponential phase of G. balechii. This suggests that this bacterium might have benefited from organic matters such as carbohydrate released by the dinoflagellate, especially during the late exponential phase of the dinoflagellate. In return, the dinoflagellate might have benefited from the bacterium as food when N was limited in the culture. Further investigations are required to verify this in the future.
Some bacteria containing CWHs are capable of hydrolyzing the stress-bearing peptidoglycan layer and therefore triggering cell lysis of other bacteria to compete in microbial community for limited nutrient sources (Parisien et al. 2008) or themselves in cell wall growth (Ishikawa et al. 1998). While some bacteria are algicidal through degrading algal cell walls (Shi et al. 2018). The plant-associated Rhizobium have been reported to produce enzymes capable of degrading plant cell wall polymers (Robledo et al. 2008).
To our knowledge, CWH has not been studied widely in algae-associated bacteria and its function in R. rosettiformans GAMBA-01 remains unclear. In the present study, we observed higher copy numbers of cwh in the N-limited cultures than in the N-replete cultures, especially in the late exponential phase of G. balechii. This is consistent with the result observed from 16S rDNA, indicating that N limitation of G. balechii can promote the growth of the GAMBA-01 strain, probably due to increased organic excreta of G. balechii, which increases under N limitation (Vanucci et al. 2010; Vidyarathna and Granéli 2013). Whether this bacterium uses CWH to degrade host cell wall or to compete with other bacteria for more nutrient sources warrants dedicated studies in the future. In future studies, the expression of the cwh should be examined under contrasting N conditions and growth stages of the dinoflagellate culture.
Gambierdiscus balechii strain M1M10 was originally isolated from Kiribati in 2012. Single-cell isolation was performed using a micropipetting technique as described before (Andersen 2005). Micropipettes used for algal cell isolation were subjected to heat melting to be sterile. The strain was maintained in the State Key Laboratory of Marine Pollution, City University of Hong Kong. The culture was grown in sterile T25 cell culture flasks (Nunc, Thermo Fisher Scientific, MA) with autoclaved and 0.22-µm filtered artificial seawater with L1 medium nutrients (without Na2SiO3 addition) (Guillard and Hargraves 1993). The sterile equipment and autoclaved seawater were used to avoid contamination. The cultures were maintained at 25 ℃ under a 14:10 light: dark regime at a photon flux of 100 μmol m−2 s−1.
A sample (10 ml) was removed from the Gambierdiscus culture and filtered through 3-μm membrane (Merck Millipore, Darmstadt, Germany). One hundred microliters of the filtrate, which was expected to contain bacteria, was spread onto a marine agar plate (Luria Bertani (LB) medium prepared using seawater and containing 1.5% agar). The plate was incubated at 25 ℃, under a 14:10 light: dark regime at a photon flux of 100 μmol m−2 s−1. Two days later, when colonies appeared, PCR was performed using colonies picked on a pipette tip directly as templates. To screen for bacteria that contained cwh (approximately 670 bp), common CWH gene primers (Table 1) were designed from conserved regions of this gene identified from an alignment of cwh sequences from various bacterial species. PCR amplification with these primers was performed under the following conditions: initial denaturation at 95 ℃ for 2 min, followed by 40 cycles of denaturation at 95 ℃ for 30 s, annealing at 55 ℃ for 30 s, and extension at 72 ℃ for 40 s, with a final extension cycle at 72 ℃ for 6 min. The PCR-positive bacterial clones were isolated into monospecific cultures for further analyses.
| Primer | Primer sequence 5′–3′ | Application | Expected amplicon size | Source |
| 27F | AGAGTTTGATCMTGGCTCAG (M is A or C) | 16S rDNA amplification | 1500 bp | Webster et al. (2003) |
| SgR | TAGGGTTACCTTGTTACGACTT | 16S rDNA amplification | Webster et al. (2003) | |
| CWH-F | CTACGGCGGAGTGGATAGTG | cwh amplification | 670 bp | This study |
| CWH-R | TAGCGACGCAGCTTCAAAGT | cwh amplification | This study | |
| Nh21F | GCIWTYTAYGGNAARGG | nifH amplification | 476 bp | Gaby and Buckley (2012) |
| nifH3 | ATRTTRTTNGCNGCRTA | nifH amplification | Gaby and Buckley (2012) | |
| q16SF | GGAATCTACCGTGCCCTACG | qPCR | 170 bp | This study |
| q16SR | AGCTATGGATCGTCGCCTTG | qPCR | This study | |
| qCWH-F | CAAGCAGGACGCAAATGGAG | qPCR | 76 bp | This study |
| qCWH-R | CGTCGGGAAATGCAAAACGA | qPCR | This study |
DownLoad:
CSV
Bacterial colonies that yielded positive results in cwh-PCR were selected and cultured in 50 ml Zobell 2216E broth at 25 ℃ for 24 h with shaking at 200 r/min. Bacterial cells were harvested via centrifugation at 3901g for 10 min and then transferred into a 2-ml micro-centrifuge tube with 0.5 ml DNA lysis buffer (Wang et al. 2017). The samples were incubated at 55 ℃ for one day. DNA extraction was conducted using a CTAB protocol combined with the Zymo DNA clean and concentrator kit (Zymo Research Corp., Orange, CA, USA) as reported previously (Zhang et al. 2005). The 16S rDNA was amplified using the following parameters: 95 ℃ for 2 min, followed by 35 cycles of denaturation at 95 ℃ for 30 s, annealing at 56 ℃ for 30 s, and extension at 72 ℃ for 1 min, with a final extension cycle at 72 ℃ for 6 min. The CWH gene was amplified as described above. Primers 27F and SgR were used for the amplification of a 1.5-kb fragment of the 16S rDNA and CWH-F and CWH-R were used for the amplification of cwh (Table 1) (Wang et al. 2017; Webster et al. 2003). The amplicons were subjected to Sanger sequencing (BGI, Shenzhen, China) directly.
Based on the 16S rDNA sequence, one of the bacterial isolates annotated as Rhizobium (see Results) was selected for further characterization. To determine whether this bacterium possesses the nifH gene, a nifH universal primer set (Nh21F and nifH3; Table 1) was used as described before (Gaby and Buckley 2012) to amplify a 476-bp fragment. Amplification was performed using the following program: initial denaturation at 95 ℃ for 2 min, followed by 40 cycles of denaturation at 95 ℃ for 30 s, annealing at 41 ℃ for 30 s, and extension at 72 ℃ for 40 s, with a final extension cycle at 72 ℃ for 6 min. The amplicons were gel purified, cloned into the PMD-19 T vector (Takara Biotechnology Co., Ltd., Beijing, China), and transformed into Escherichia coli DH5α competent cells (Takara Biotechnology Co., Ltd., Beijing, China). The resulting clones were randomly selected for Sanger sequencing.
To create different algal growth conditions and examine the dynamics of the selected coexisting bacterium (Rhizobium), two contrasting nitrogen nutrient conditions were used in the otherwise L1 medium (without Na2SiO3) based on autoclaved artificial seawater. Specifically, 4.41 μmol/L and 882 μmol/L NaNO3 were added to L1 medium for the preparation of N-limited and N-replete cultures, respectively. No more nitrogeneous compound was added during the experiment. Both N-replete (serving as control) and N-limited treatments were performed in triplicate. Eighty milliliters xenic G. balechii was inoculated into the two sets of cultures in 800-ml mediums. From Day 1, samples were collected every two days from each of the cultures for cell enumeration and measurement of cell size and chlorophyll a content. Algal cells were fixed in Lugol' s solution and examined microscopically with a Sedgewick-Rafter counting chamber (Lin et al. 2012). Growth curves of G. balechii were presented as relative cell concentrations. Specifically, cell concentration on Day 1 was set as 1 and cell concentrations on subsequent days were calculated as ratio to Day 1. The mean cell size was measured as equivalent spherical diameter under the Nikon ECLIPSE 90i digital microscope (Nikon, Japan). Chlorophyll a content was determined using a microplate reader (BMG Polarstar Optima) after filtration of the sub-samples (5 to 10 ml) through Whatman GF/F glass circles (25 mm) (Merck KGaA, Darmstadt, Germany) and 90% acetone extraction of the filtrate for 24 h in the dark at 4 ℃ (Ritchie 2006).
On Day 40 (early exponential phase) and Day 61 (late exponential phase), 10 ml of the G. balechii culture was collected from each treatment and was filtered using a 0.22-μm nitrocellulose membrane (Merck Millipore, Darmstadt, Germany). The membrane retaining the cells was then transferred into a 2-ml micro-centrifuge tube containing 1 ml DNA lysis buffer (containing 0.1 mol/L EDTA, 1% sodium dodecyl sulfate, and 8 µg lysozyme). The samples were incubated at 55 ℃ and DNA extraction was conducted as described above.
Copy numbers of the 16S rDNA and CWH-encoding gene were determined using qPCR on the StepOnePlus real-time PCR system (Applied Biosystems, USA). Specific primers (q16SF and q16SR; Table 1) were designed based on the 16S rDNA sequences obtained from the Rhizobium bacterium isolated in the present study. For cwh, primers qCWH-F and qCWH-R (Table 1) were also designed based on the sequence obtained from our Sanger sequencing result. The PCR products were purified using a Takara MiniBEST Agarose Gel DNA Extraction Kit (Ver 4.0, Takara Biotechnology Co., Ltd., Beijing, China) and prepared in serial tenfold dilutions to be used as standards. The same molar quantity of genomic DNA (0.01 ng) was used as the template to amplify the target gene from each group (N-replete and N-limited). Their copy numbers were calculated based on the standards, which were amplified on the same PCR runs as the samples. Each PCR was performed in a total volume of 10 µl containing 5 µl of 2 × iQSYBR Green supermix (Bio-Rad, USA), 200 nmol/L of each primer, and 4 µl of 0.01 ng/μl DNA. The PCR program consisted of a denaturation step of 95 ℃ for 30 s, followed by 40 cycles of 95 ℃ for 5 s and 59 ℃ for 30 s. Each reaction had two technical replicates. Finally, all the PCR products were subjected to melting curve analysis to confirm primer specificity (melt curve showing single peak; Supplementary Figs. S1 and S2).
Phylogenetic trees were constructed to determine the phylogenetic relationship of the bacterium strain with known bacteria. 16S rDNA sequences as well as CWH amino acid sequences from species closely related to the isolate obtained in this study were downloaded from NCBI and combined with the sequences generated from this study to form a dataset. The alignment of these 16S rDNA sequences was performed using ClustalW via MEGA7 (Kumar et al. 2016). MUSCLE via MEGA7 was employed for the analysis of CWH amino acid sequences. Prior to phylogenetic analyses, the best DNA substitution models were identified based on the Akaike information criterion (Nei and Kumar 2000), which were K2 + G for 16S rDNA sequences and JTT + G for CWH amino acid sequences. Maximum likelihood and neighbor-joining phylogenetic trees were created using MEGA7 with 1000 bootstraps (Kumar et al. 2016), which yielded similar tree topologies.
To compare the differences in the variables between the N-replete and N-limited groups, an analysis of variance (ANOVA) was conducted using the SPSS Statistics 17.0 software package. Significant difference was set at P < 0.05. All data presented are means with standard deviation calculated from the triplicate cultures under each N condition.
The online version contains supplementary material available at https://doi.org/10.1007/mlst-3-4-542.
The research was funded by the Collaborative Research Fund from the Research Grant Council [C1012-15G] of Hong Kong. We thank Mr. Kaidian Zhang and Dr. Hua Zhang for their assistance in this study.
ZW and SL: designed the research; ZW, XL, and WHL: performed the laboratory work; ZW: performed the data analysis; ZW, SL, and PKSL: wrote the paper.
The authors declared that they have no conflicts of interest to this work.
This article does not contain any studies with human participants or animals performed by the authors.
The 16S rRNA gene sequence of Rhizobium rosettiformans strain GAMBA-01 is available in the National Center for Biotechnology Information (NCBI), accession number MN577391. The cell wall hydrolase and chlorophyllide a reductase iron protein subunit X sequences are available in NCBI and their accession numbers are MN714645 and MN714646, respectively.
|
Aagaard J, Sistrom W (1972) Control of synthesis of reaction center bacteriochlorophyll in photosynthetic bacteria. Photochem Photobiol 15: 209-225 doi: 10.1111/j.1751-1097.1972.tb06240.x
|
|
Alavi M, Miller T, Erlandson K, Schneider R, Belas R (2001) Bacterial community associated with Pfiesteria-like dinoflagellate cultures. Environ Microbiol 3: 380-396 doi: 10.1046/j.1462-2920.2001.00207.x
|
|
Amin SA, Green DH, Gärdes A, Romano A, Trimble L, Carrano CJ (2012) Siderophore-mediated iron uptake in two clades of Marinobacter spp. associated with phytoplankton: the role of light. Biometals 25: 181-192 http://europepmc.org/abstract/MED/21947474
|
|
Amin SA, Hmelo LR, van Tol HM, Durham BP, Carlson LT, Heal KR, Morales RL, Berthiaume CT, Parker MS, Djunaedi B, Ingalls AE, Parsek MR, Moran MA, Armbrust EV (2015) Interaction and signalling between a cosmopolitan phytoplankton and associated bacteria. Nature 522: 98-101 doi: 10.1038/nature14488
|
|
Andersen RA (2005) Algal culturing techniques. Elsevier, New York, p 596
|
|
Anderson JM, Macfadyen A (1976) The role of terrestrial and aquatic organisms in decomposition processes. In: Proceedings of the 17th symposium of the BES
|
|
Axler RP, Redfield GW, Goldman CR (1981) The importance of regenerated nitrogen to phytoplankton productivity to phytoplankton productivity in a subalpine lake. Ecology 62: 345-354 doi: 10.2307/1936709
|
|
Biebl H, Allgaier M, Tindall BJ, Koblizek M, Lünsdorf H, Pukall R, Wagner-Döbler I (2005) Dinoroseobacter shibae gen. nov., sp. nov., a new aerobic phototrophic bacterium isolated from dinoflagellates. Int J Syst Evol Microbiol 55: 1089-1096 doi: 10.1099/ijs.0.63511-0
|
|
Biebl H, Tindall BJ, Pukall R, Lünsdorf H, Allgaier M, Wagner-Döbler I (2006) Hoeflea phototrophica sp. nov., a novel marine aerobic alphaproteobacterium that forms bacteriochlorophyll a. Int J Syst Evol Microbiol 56: 821-826 doi: 10.1099/ijs.0.63958-0
|
|
Bloesch J, Stadelmann P, Bührer H (1977) Primary production, mineralization, and sedimentation in the euphotic zone of two Swiss lakes. Limnol Oceanogr 22: 511-526 doi: 10.4319/lo.1977.22.3.0511
|
|
Brinkmeyer R, Rappé M, Gallacher S, Medlin L (2000) Development of clade-(Roseobacter and Alteromonas) and taxon-specific oligonucleotide probes to study interactions between toxic dinoflagellates and their associated bacteria. Eur J Phycol 35: 315-329 doi: 10.1080/09670260010001735921
|
|
Cole JJ (1982) Interactions between bacteria and algae in aquatic ecosystems. Annu Rev Ecol Syst 13: 291-314 doi: 10.1146/annurev.es.13.110182.001451
|
|
Croft MT, Lawrence AD, Raux-Deery E, Warren MJ, Smith AG (2005) Algae acquire vitamin B12 through a symbiotic relationship with bacteria. Nature 438: 90-93 doi: 10.1038/nature04056
|
|
Dai X, Mak YL, Lu CK, Mei HH, Wu JJ, Lee WH, Chan LL, Lim PT, Mustapa NI, Lim HC, Wolf M, Li D, Luo Z, Gu H, Leaw CP, Lu D (2017) Taxonomic assignment of the benthic toxigenic dinoflagellate Gambierdiscus sp. type 6 as Gambierdiscus balechii (Dinophyceae), including its distribution and ciguatoxicity. Harmful Algae 67: 107-118 http://www.sciencedirect.com/science/article/pii/S156898831730104X
|
|
Delucca R, McCracken MD (1977) Observations on interactions between naturally-collected bacteria and several species of algae. Hydrobiologia 55: 71-75 doi: 10.1007/BF00034807
|
|
Dittami SM, Barbeyron T, Boyen C, Cambefort J, Collet G, Delage L, Gobet A, Groisillier A, Leblanc C, Michel G, Scornet D, Siegel A, Tapia JE, Tonon T (2014) Genome and metabolic network of "Candidatus Phaeomarinobacter ectocarpi" Ec32, a new candidate genus of Alphaproteobacteria frequently associated with brown algae. Front Genet 5: 241 http://europepmc.org/abstract/MED/25120558
|
|
Dittami SM, Duboscq-Bidot L, Perennou M, Gobet A, Corre E, Boyen C, Tonon T (2016) Host-microbe interactions as a driver of acclimation to salinity gradients in brown algal cultures. ISME J 10: 51-63 doi: 10.1038/ismej.2015.104
|
|
Fisher RF, Long SR (1992) Rhizobium-plant signal exchange. Nature 357: 655-660 doi: 10.1038/357655a0
|
|
Gaby JC, Buckley DH (2012) A comprehensive evaluation of PCR primers to amplify the nifH gene of nitrogenase. PLoS ONE 7: e42149 doi: 10.1371/journal.pone.0042149
|
|
Golterman H (1972) Role of phytoplankton in detritus formation. Memorie dell'Istituto Italiano di Idrobiologia 29: 89-103
|
|
Guillard R, Hargraves P (1993) Stichochrysis immobilis is a diatom, not a chrysophyte. Phycologia 32: 234-236 doi: 10.2216/i0031-8884-32-3-234.1
|
|
Gutierrez T, Green DH, Whitman WB, Nichols PD, Semple KT, Aitken MD (2012) Algiphilus aromaticivorans gen. nov., sp. nov., an aromatic hydrocarbon-degrading bacterium isolated from a culture of the marine dinoflagellate Lingulodinium polyedrum, and proposal of Algiphilaceae fam. nov. Int J Syst Evol Microbiol 62: 2743-2749 doi: 10.1099/ijs.0.033324-0
|
|
Hodkinson BP, Lutzoni F (2009) A microbiotic survey of lichen-associated bacteria reveals a new lineage from the Rhizobiales. Symbiosis 49: 163-180 doi: 10.1007/s13199-009-0049-3
|
|
Ishikawa S, Hara Y, Ohnishi R, Sekiguchi J (1998) Regulation of a new cell wall hydrolase gene, cwlF, which affects cell separation in Bacillus subtilis. J Bacteriol 180: 2549-2555 doi: 10.1128/JB.180.9.2549-2555.1998
|
|
Jeong HJ, Seong KA, Yoo YD, Kim TH, Kang NS, Kim S, Park JY, Kim JS, Kim GH, Song JY (2008) Feeding and grazing impact by small marine heterotrophic dinoflagellates on heterotrophic bacteria. J Eukaryot Microbiol 55: 271-288 doi: 10.1111/j.1550-7408.2008.00336.x
|
|
Kaur J, Verma M, Lal R (2011) Rhizobium rosettiformans sp. nov., isolated from a hexachlorocyclohexane dump site, and reclassification of Blastobacter aggregatus Hirsch and Müller 1986 as Rhizobium aggregatum comb. nov. Int J Syst Evol Microbiol 61: 1218-1225 doi: 10.1099/ijs.0.017491-0
|
|
Kim JD, Kim JY, Park JK, Lee CG (2009) Selective control of the prorocentrum minimum harmful algal blooms by a novel algal-lytic bacterium pseudoalteromonas haloplanktis AFMB-008041. Mar Biotechnol 11: 463-472 doi: 10.1007/s10126-008-9167-9
|
|
Kim B-H, Ramanan R, Cho D-H, Oh H-M, Kim H-S (2014a) Role of Rhizobium, a plant growth promoting bacterium, in enhancing algal biomass through mutualistic interaction. Biomass Bioenergy 69: 95-105 doi: 10.1016/j.biombioe.2014.07.015
|
|
Kim M, Oh HS, Park SC, Chun J (2014b) Towards a taxonomic coherence between average nucleotide identity and 16S rRNA gene sequence similarity for species demarcation of prokaryotes. Int J Syst Evol Microbiol 64: 346-351 doi: 10.1099/ijs.0.059774-0
|
|
Krause G, Weis E (1991) Chlorophyll fluorescence and photosynthesis: the basics. Annu Rev Plant Biol 42: 313-349 doi: 10.1146/annurev.pp.42.060191.001525
|
|
Kumar S, Stecher G, Tamura K (2016) MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol 33: 1870-1874 doi: 10.1093/molbev/msw054
|
|
LaJeunesse TC, Parkinson JE, Gabrielson PW, Jeong HJ, Reimer JD, Voolstra CR, Santos SR (2018) Systematic revision of Symbiodiniaceae highlights the antiquity and diversity of coral endosymbionts. Curr Biol 28(2570-2580): e2576 http://www.sciencedirect.com/science/article/pii/S0960982218309072
|
|
Lartigue J, Jester EL, Dickey R, Villareal T (2009) Nitrogen source effects on the growth and toxicity of two strains of the ciguatera-causing dinoflagellate Gambierdiscus toxicus. Harmful Algae 8: 781-791 doi: 10.1016/j.hal.2008.05.006
|
|
Li M, Shi X, Guo C, Lin S (2016) Phosphorus deficiency inhibits cell division but not growth in the dinoflagellate Amphidinium carterae. Front microbiol 7: 826 http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4887478/
|
|
Lin X, Zhang H, Huang B, Lin S (2012) Alkaline phosphatase gene sequence characteristics and transcriptional regulation by phosphate limitation in Karenia brevis (Dinophyceae). Harmful Algae 17: 14-24 doi: 10.1016/j.hal.2012.02.005
|
|
Mitsustin E, Sil'nikova V (1968) Biological fixation of atmospheric nitrogen. Nauka, Moscow
|
|
Nakanishi K, Nishijima M, Nishimura M, Kuwano K, Saga N (1996) Bacteria that induce morphogenesis in Ulva pertusa (Chlorophyta) grown under axenic conditions. J Phycol 32: 479-482 doi: 10.1111/j.0022-3646.1996.00479.x
|
|
Nei M, Kumar S (2000) Molecular evolution and phylogenetics. Oxford University Press, Oxford
|
|
Nomata J, Mizoguchi T, Tamiaki H, Fujita Y (2006) A second nitrogenase-like enzyme for bacteriochlorophyll biosynthesis: reconstitution of chlorophyllide a reductase with purified x-protein (bchX) and yz-protein (bchY-bchZ) from Rhodobacter capsulatus. J Biol Chem 281: 15021-15028 doi: 10.1074/jbc.M601750200
|
|
Palacios L, Arahal DR, Reguera B, Marín I (2006) Hoeflea alexandrii sp. nov., isolated from the toxic dinoflagellate Alexandrium minutum AL1V. Int J Syst Evol Microbiol 56: 1991-1995 doi: 10.1099/ijs.0.64238-0
|
|
Parisien A, Allain B, Zhang J, Mandeville R, Lan C (2008) Novel alternatives to antibiotics: bacteriophages, bacterial cell wall hydrolases, and antimicrobial peptides. J Appl Microbiol 104: 1-13 http://europepmc.org/abstract/MED/18171378
|
|
Platt T, Rao DS, Irwin B (1983) Photosynthesis of picoplankton in the oligotrophic ocean. Nature 301: 702 doi: 10.1038/301702a0
|
|
Price DC, Farinholt N, Gates C, Shumaker A, Wagner NE, Bienfang P, Bhattacharya D (2016) Analysis of Gambierdiscus transcriptome data supports ancient origins of mixotrophic pathways in dinoflagellates. Environ Microbiol 18: 4501-4510 doi: 10.1111/1462-2920.13478
|
|
Rambo IM, Dombrowski N, Constant L, Erdner D, Baker BJ (2020) Metabolic relationships of uncultured bacteria associated with the microalgae Gambierdiscus. Environ Microbiol 22: 1764-1783 doi: 10.1111/1462-2920.14878
|
|
Ritchie RJ (2006) Consistent sets of spectrophotometric chlorophyll equations for acetone, methanol and ethanol solvents. Photosynth Res 89: 27-41 doi: 10.1007/s11120-006-9065-9
|
|
Robledo M, Jimenez-Zurdo JI, Velazquez E, Trujillo ME, Zurdo-Pineiro JL, Ramirez-Bahena MH, Ramos B, Diaz-Minguez JM, Dazzo F, Martinez-Molina E (2008) Rhizobium cellulase CelC2 is essential for primary symbiotic infection of legume host roots. Proc Natl Acad Sci USA 105: 7064-7069 doi: 10.1073/pnas.0802547105
|
|
Sakami T, Nakahara H, Chinain M, Ishida Y (1999) Effects of epiphytic bacteria on the growth of the toxic dinoflagellate Gambierdiscus toxicus (Dinophyceae). J Exp Mar Biol Ecol 233: 231-246 doi: 10.1016/S0022-0981(98)00130-0
|
|
Shi X, Liu L, Li Y, Xiao Y, Ding G, Lin S, Chen J (2018) Isolation of an algicidal bacterium and its effects against the harmful-algal-bloom dinoflagellate Prorocentrum donghaiense (Dinophyceae). Harmful Algae 80: 72-79 doi: 10.1016/j.hal.2018.09.003
|
|
Shoguchi E, Shinzato C, Kawashima T, Gyoja F, Satoh N (2013) Draft assembly of the Symbiodinium minutum nuclear genome reveals dinoflagellate gene structure. Curr Biol 23: 1399-1408 doi: 10.1016/j.cub.2013.05.062
|
|
Sule P, Belas R (2013) A novel inducer of Roseobacter motility is also a disruptor of algal symbiosis. J Bacteriol 195: 637-646 doi: 10.1128/JB.01777-12
|
|
Tang YZ, Koch F, Gobler CJ (2010) Most harmful algal bloom species are vitamin B1 and B12 auxotrophs. Proc Natl Acad Sci 107: 20756-20761 doi: 10.1073/pnas.1009566107
|
|
Tosteson T, Ballantine D, Tosteson C, Hensley V, Bardales A (1989) Associated bacterial flora, growth, and toxicity of cultured benthic dinoflagellates Ostreopsis lenticularis and Gambierdiscus toxicus. Appl Environ Microbiol 55: 137-141 doi: 10.1128/aem.55.1.137-141.1989
|
|
Vanucci S, Guerrini F, Milandri A, Pistocchi R (2010) Effects of different levels of N-and P-deficiency on cell yield, okadaic acid, DTX-1, protein and carbohydrate dynamics in the benthic dinoflagellate Prorocentrum lima. Harmful Algae 9: 590-599 http://www.sciencedirect.com/science/article/pii/S156898831000048X
|
|
Vermassen A, Leroy S, Talon R, Provot C, Popowska M, Desvaux M (2019) Cell wall hydrolases in bacteria: insight on the diversity of cell wall amidases, glycosidases and peptidases toward peptidoglycan. Front Microbiol 10: 331 doi: 10.3389/fmicb.2019.00331
|
|
Vidyarathna NK, Granéli E (2013) Physiological responses of Ostreopsis ovata to changes in N and P availability and temperature increase. Harmful Algae 21: 54-63 http://www.sciencedirect.com/science/article/pii/S1568988312001631
|
|
Wang C, Lin X, Li L, Lin L, Lin S (2017) Glyphosate shapes a dinoflagellate-associated bacterial community while supporting algal growth as sole phosphorus source. Front Microbiol 8: 2530 doi: 10.3389/fmicb.2017.02530
|
|
Webster G, Newberry CJ, Fry JC, Weightman AJ (2003) Assessment of bacterial community structure in the deep sub-seafloor biosphere by 16S rDNA-based techniques: a cautionary tale. J Microbiol Methods 55: 155-164 doi: 10.1016/S0167-7012(03)00140-4
|
|
Wiese M (2012) Investigations into abiotic and biotic factors regulating saxitoxin synthesis in the dinoflagellate genus Alexandrium. Dissertation, University of New South Wales Australia
|
|
Zhang H, Bhattacharya D, Lin S (2005) Phylogeny of dinoflagellates based on mitochondrial cytochrome b and nuclear small subunit rDNA sequence comparisons. J Phycol 41: 411-420 doi: 10.1111/j.1529-8817.2005.04168.x
|
|
Zhang C, Lin S, Huang L, Lu W, Li M, Liu S (2014) Suppression subtraction hybridization analysis revealed regulation of some cell cycle and toxin genes in Alexandrium catenella by phosphate limitation. Harmful Algae 39: 26-39 doi: 10.1016/j.hal.2014.06.005
|
| 1. | Xiaohong Yang, Zijian Liu, Yanwen Zhang, et al. Dinoflagellate–Bacteria Interactions: Physiology, Ecology, and Evolution. Biology, 2024, 13(8): 579. DOI:10.3390/biology13080579 |
| 2. | Stephen J. Taerum, Blaire Steven, Daniel Gage, et al. Dominance of Ciliophora and Chlorophyta Among Phyllosphere Protists of Solanaceous Plants. Phytobiomes Journal, 2023, 7(2): 270. DOI:10.1094/PBIOMES-04-22-0021-FI |
| 3. | Lindsay R. Triplett, Stephen J. Taerum, Ravikumar R. Patel. Protists at the plant-bacterial interface: Impacts and prospective applications. Physiological and Molecular Plant Pathology, 2023, 125: 102011. DOI:10.1016/j.pmpp.2023.102011 |
| 4. | Zhen Wu, Wai Hin Lee, Zijian Liu, et al. Microbiome Associated With Gambierdiscus balechii Cultures Under Different Toxicity Conditions. Frontiers in Marine Science, 2022, 9 DOI:10.3389/fmars.2022.760553 |
Figures(5) / Tables(1)
Supported by: Beijing Renhe Information Technology Co.,
Ltd.
support:
info@rhhz.net
| Primer | Primer sequence 5′–3′ | Application | Expected amplicon size | Source |
| 27F | AGAGTTTGATCMTGGCTCAG (M is A or C) | 16S rDNA amplification | 1500 bp | Webster et al. (2003) |
| SgR | TAGGGTTACCTTGTTACGACTT | 16S rDNA amplification | Webster et al. (2003) | |
| CWH-F | CTACGGCGGAGTGGATAGTG | cwh amplification | 670 bp | This study |
| CWH-R | TAGCGACGCAGCTTCAAAGT | cwh amplification | This study | |
| Nh21F | GCIWTYTAYGGNAARGG | nifH amplification | 476 bp | Gaby and Buckley (2012) |
| nifH3 | ATRTTRTTNGCNGCRTA | nifH amplification | Gaby and Buckley (2012) | |
| q16SF | GGAATCTACCGTGCCCTACG | qPCR | 170 bp | This study |
| q16SR | AGCTATGGATCGTCGCCTTG | qPCR | This study | |
| qCWH-F | CAAGCAGGACGCAAATGGAG | qPCR | 76 bp | This study |
| qCWH-R | CGTCGGGAAATGCAAAACGA | qPCR | This study |
DownLoad:
CSV
