+Advanced Search
Volume 2 Issue 4
Nov.  2020
Article Contents

Citation:

High abundance and reproductive output of an intertidal limpet (Siphonaria japonica) in environments with high thermal predictability

  • Corresponding author: Yunwei Dong, dongyw@ouc.edu.cn
  • Received Date: 2020-04-16
    Accepted Date: 2020-06-17
    Published online: 2020-09-28
  • Edited by Jiamei Li.
  • The predictability of high temperatures is important for intertidal species for coping with thermal stress. To investigate the roles of high temperature and its predictability on the population abundance and reproductive output of an intertidal rocky shore limpet, Siphonaria japonica, we monitored the operative temperature, recorded the population abundance of egg ribbons and adults, and quantified the expression of heat shock protein 70 (hsp70) mRNA on two warm-temperate rocky shores with different thermal environments. Abundances of limpets and egg ribbons in the hotter but more predictable (HP) habitats were higher than those in the relatively benign and unpredictable (BU) habitats. In the HP habitats, there was a strong positive correlation between habitat temperature and population abundance. For limpets living in the HP habitats, the expression of hsp70 exhibited a smaller increase with rising body temperature than for BU limpets, indicating the existence in HP limpets of a preparatory strategy in cellular stress response against thermal stress. Our results demonstrate that the predictability of operative temperature can affect physiological responses and population dynamics. The importance of predictability should be considered in analyses of the ecological consequences of climate warming.
  • 加载中
  • Abe N (1940) The homing, spawning and other habits of a limpet, Siphonaria japonica Donovan. Sci Rep Tohoku Imp Univ 15:59–95
    Botero CA, Weissing FJ, Wright J, Rubenstein DR (2015) Evolutionary tipping points in the capacity to adapt to environmental change. Proc Natl Acad Sci USA 112:184–189 doi: 10.1073/pnas.1408589111
    Brown BE, Downs CA, Dunne RP, Gibb SW (2002) Exploring the basis of thermotolerance in the reef coral Goniastrea aspera. Mar Ecol Prog Ser 242:119–129 doi: 10.3354/meps242119
    Burgess SC, Marshall DJ (2014) Adaptive parental effects: the importance of estimating environmental predictability and offspring fitness appropriately. Oikos 123:769–776 doi: 10.1111/oik.01235
    Cohen D (1966) Optimizing reproduction in a randomly varying environment. J Theor Biol 12:119–129 doi: 10.1016/0022-5193(66)90188-3
    Connor KM, Gracey AY (2011) Circadian cycles are the dominant transcriptional rhythm in the intertidal mussel Mytilus californianus. Proc Natl Acad Sci USA 108:16110–16115 doi: 10.1073/pnas.1111076108
    Daan S, Tinbergen JM (1997) Adaptation of life histories. In: Krebs JR, Davies NB (eds) Behavioural ecology: an evolutionary approach. Wiley, Hoboken, pp 311–333
    Dayrat B, Goulding TC, White TR (2014) Diversity of indo-west pacific Siphonaria (Mollusca: Gastropoda: Euthyneura). Zootaxa 3779:246–276 doi: 10.11646/zootaxa.3779.2.7
    Denny MW, Dowd WW (2012) Biophysics, environmental stochasticity, and the evolution of thermal safety margins in intertidal limpets. J Exp Biol 215:934–947 doi: 10.1242/jeb.058958
    Denny MW, Hunt LJ, Miller LP, Harley CD (2009) On the prediction of extreme ecological events. Ecol Monogr 79:397–421 doi: 10.1890/08-0579.1
    Di Cecco GJ, Gouhier TC (2018) Increased spatial and temporal autocorrelation of temperature under climate change. Sci Rep 8:14850 doi: 10.1038/s41598-018-33217-0
    Dillon ME, Woods HA, Wang G, Fey SB, Vasseur DA, Telemeco RS, Marshall K, Pincebourde S (2016) Life in the frequency domain: the biological impacts of changes in climate variability at multiple time scales. Integr Comp Biol 56:14–30 doi: 10.1093/icb/icw024
    Dong Y, Miller LP, Sanders JG, Somero GN (2008) Heat-shock protein 70 (Hsp70) expression in four limpets of the genus Lottia: interspecific variation in constitutive and inducible synthesis correlates with in situ exposure to heat stress. Biol Bull 215:173–181 doi: 10.2307/25470698
    Dong YW, Han GD, Ganmanee M, Wang J (2015) Latitudinal variability of physiological responses to heat stress of the intertidal limpet Cellana toreuma along the Asian coast. Mar Ecol Prog Ser 529:107–119 doi: 10.3354/meps11303
    Dong YW, Li XX, Choi FM, Williams GA, Somero GN, Helmuth B (2017) Untangling the roles of microclimate, behaviour and physiological polymorphism in governing vulnerability of intertidal snails to heat stress. Proc R Soc B 284:20162367 doi: 10.1098/rspb.2016.2367
    Drake MJ, Miller NA, Todgham AE (2017) The role of stochastic thermal environments in modulating the thermal physiology of an intertidal limpet, Lottia digitalis. J Exp Biol 220:3072–3083 doi: 10.1242/jeb.159020
    Ejsmond MJ, Czarnołęski M, Kapustka F, Kozłowski J (2010) How to time growth and reproduction during the vegetative season: an evolutionary choice for indeterminate growers in seasonal environments. Am Nat 175:551–563 doi: 10.1086/651589
    Etschmann B, Wilcken B, Stoevesand K, Von Der Schulenburg A, Sterner-Kock A (2006) Selection of reference genes for quantitative real-time PCR analysis in canine mammary tumors using the GeNorm algorithm. Vet Pathol 43:934–942 doi: 10.1354/vp.43-6-934
    Feder ME, Hofmann GE (1999) Heat-shock proteins molecular chaperones and the stress response: evolutionary and ecological physiology. Annu Rev Physiol 61:243–282 doi: 10.1146/annurev.physiol.61.1.243
    Firth LB, Williams GA (2009) The influence of multiple environmental stressors on the limpet Cellana toreuma during the summer monsoon season in Hong Kong. J Exp Mar Biol Ecol 375:70–75 doi: 10.1016/j.jembe.2009.05.011
    Gracey AY, Chaney ML, Boomhower JP, Tyburczy WR, Connor K, Somero GN (2008) Rhythms of gene expression in a fluctuating intertidal environment. Curr Biol 18:1501–1507 doi: 10.1016/j.cub.2008.08.049
    Han GD, Cartwright SR, Ganmanee M, Chan BK, Adzis KA, Hutchinson N, Wang J, Hui TY, Williams GA, Dong YW (2019) High thermal stress responses of Echinolittorina snails at their range edge predict population vulnerability to future warming. Sci Total Environ 647:763–771 doi: 10.1016/j.scitotenv.2018.08.005
    Harley CD (2008) Tidal dynamics, topographic orientation, and temperature-mediated mass mortalities on rocky shores. Mar Ecol Prog Ser 371:37–46 doi: 10.3354/meps07711
    Harris RM, Beaumont LJ, Vance TR, Tozer CR, Remenyi TA, PerkinsKirkpatrick SE, Mitchell PJ, Nicotra AB, McGregor S, Andrew NR, Letnic M, Kearney MR, Wernberg T, Hutley LB, Chambers LE, Fletcher MS, Keatley MR, Woodward CA, Williamson G, Duke NC et al (2018) Biological responses to the press and pulse of climate trends and extreme events. Nat Clim Change 8:579 doi: 10.1038/s41558-018-0187-9
    Helmuth B, Harley CD, Halpin PM, O'Donnell M, Hofmann GE, Blanchette CA (2002) Climate change and latitudinal patterns of intertidal thermal stress. Science 298:1015–1017 doi: 10.1126/science.1076814
    Helmuth B, Broitman BR, Blanchette CA, Gilman S, Halpin P, Harley CD, O'Donnell MJ, Hofmann GE, Menge B, Strickland D (2006) Mosaic patterns of thermal stress in the rocky intertidal zone: implications for climate change. Ecol Monogr 76:461–479 doi: 10.1890/0012-9615(2006)076[0461:MPOTSI]2.0.CO;2
    Hillyard G, Clark MS (2012) RNA preservation of antarctic marine invertebrates. Polar Biol 35:633–636 doi: 10.1007/s00300-011-1088-9
    Hirano Y (1980) Siphonaria (pulmonate limpet) survey of Japan-Ⅱ. Periodicity of spawning activity in Siphonaria japonica. Publ Seto Mar Biol Lab 25:335–342 
    Hirano Y, Inaba A (1980) Siphonaria (pulmonate limpet) survey of Japan-Ⅰ. Observations on the behavior of Siphonaria japonica during breeding season. Publ Seto Mar Biol Lab 25:323–334 
    Hofmann GE, Todgham AE (2010) Living in the now: physiological mechanisms to tolerate a rapidly changing environment. Annu Rev Physiol 72:127–145 doi: 10.1146/annurev-physiol-021909-135900
    Houston AI, McNamara JM (1999) Models of adaptive behaviour: an approach based on state. Cambridge University Press, Cambridge
    IPCC (2013) Summary for policymakers. In: Stocker TF, Qin D, Plattner GK, Tignor M, Allen SK, Boschung J, Nauels A, Xia Y, Bex V, Midgley PM (eds) Climate change 2013: the physical science basis. Contribution of working group I to the fifth assessment report of the intergovernmental panel on climate change. Cambridge University Press, New York
    Koenig WD, Liebhold AM (2016) Temporally increasing spatial synchrony of North American temperature and bird populations. Nat Clim Change 6:614 doi: 10.1038/nclimate2933
    Lima FP, Wethey DS (2009) Robolimpets: measuring intertidal body temperatures using biomimetic loggers. Limnol Oceanogr Methods 7:347–353 doi: 10.4319/lom.2009.7.347
    Liu JH (1994) Distribution and population dynamics of three populations of Siphonaria on rocky intertidal shores in Hong Kong. J Molluscan Stud 60:431–443 doi: 10.1093/mollus/60.4.431
    Nadeau CP, Urban MC, Bridle JR (2017) Climates past, present, and yet-to-come shape climate change vulnerabilities. Trends Ecol Evol 32:786–800 doi: 10.1016/j.tree.2017.07.012
    Pörtner HO, Farrell AP (2008) Physiology and climate change. Science 322:690–692 doi: 10.1126/science.1163156
    R Core Team (2014) A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna
    Reznick DN, Braun B (1987) Fat cycling in the mosquitofish (Gambusia affinis): fat storage as a reproductive adaptation. Oecologia 73:401–413 doi: 10.1007/BF00385257
    Schwager M, Johst K, Jeltsch F (2006) Does red noise increase or decrease extinction risk? Single extreme events versus series of unfavorable conditions. Am Nat 167:879–888 doi: 10.1086/503609
    Shama LN (2015) Bet hedging in a warming ocean: predictability of maternal environment shapes offspring size variation in marine sticklebacks. Glob Change Biol 21:4387–4400 doi: 10.1111/gcb.13041
    Sokolova IM, Frederich M, Bagwe R, Lannig G, Sukhotin AA (2012) Energy homeostasis as an integrative tool for assessing limits of environmental stress tolerance in aquatic invertebrates. Mar Environ Res 79:1–5 doi: 10.1016/j.marenvres.2012.04.003
    Somero GN (2012) The physiology of global change: linking patterns to mechanisms. Annu Rev Mar Sci 4:39–61 doi: 10.1146/annurev-marine-120710-100935
    Somero GN (2020) The cellular stress response and temperature: function, regulation, and evolution. J Exp Zool 333:379–397 doi: 10.1002/jez.2344
    Somero GN, Lockwood BL, Tomanek L (2017) Biochemical adaptation: response to environmental challenges, from life's origins to the Anthropocene. Sinauer Associates Incorporated Publishers, Sunderland
    Tomanek L, Sanford E (2003) Heat-shock protein 70 (Hsp70) as a biochemical stress indicator: an experimental field test in two congeneric intertidal gastropods (Genus: Tegula). Biol Bull 205:276–284 doi: 10.2307/1543291
    Tomanek L, Zuzow MJ (2010) The proteomic response of the mussel congeners Mytilus galloprovincialis and M. trossulus to acute heat stress: implications for thermal tolerance limits and metabolic costs of thermal stress. J Exp Biol 213:3559–3574 doi: 10.1242/jeb.041228
    Tonkin JD, Bogan MT, Bonada N, Rios-Touma B, Lytle DA (2017) Seasonality and predictability shape temporal species diversity. Ecology 98:1201–1216 doi: 10.1002/ecy.1761
    Tufto J (2015) Genetic evolution, plasticity, and bet-hedging as adaptive responses to temporally autocorrelated fluctuating selection: a quantitative genetic model. Evolution 69:2034–2049 doi: 10.1111/evo.12716
    van der Bolt B, van Nes EH, Bathiany S, Vollebregt ME, Scheffer M (2018) Climate reddening increases the chance of critical transitions. Nat Clim Change 8:478–484 doi: 10.1038/s41558-018-0160-7
    Varpe Ø (2017) Life history adaptations to seasonality. Integr Comp Biol 57:943–960 doi: 10.1093/icb/icx123
    Vasseur DA, DeLong JP, Gilbert B, Greig HS, Harley CD, McCann KS, Savage VM, Tunney TD, O'Connor MI (2014) Increased temperature variation poses a greater risk to species than climate warming. Proc R Soc B 281:20132612 doi: 10.1098/rspb.2013.2612
    Vázquez DP, Gianoli E, Morris WF, Bozinovic F (2017) Ecological and evolutionary impacts of changing climatic variability. Biol Rev 92:22–42 doi: 10.1111/brv.12216
    Venables WN, Ripley BD (2002) Generalized linear models. In: Venables WN, Ripley BD (eds) Modern Applied Statistics with S. Springer, New York, pp 211–240
    Wang W, Ding MW, Li XX, Wang J, Dong YW (2017) Divergent thermal sensitivities among different life stages of the pulmonate limpet Siphonaria japonica. Mar Biol 164:125 doi: 10.1007/s00227-017-3157-2
  • 加载中
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Figures(5) / Tables(4)

Article Metrics

Article views(262) PDF downloads(8) Cited by()

Related
Proportional views

High abundance and reproductive output of an intertidal limpet (Siphonaria japonica) in environments with high thermal predictability

    Corresponding author: Yunwei Dong, dongyw@ouc.edu.cn
  • 1. The Key Laboratory of Mariculture, Ministry of Education, Fisheries College, Ocean University of China, Qingdao 266003, China
  • 2. Function Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266235, China
  • 3. Zhejiang Key Laboratory of Exploitation and Preservation of Coastal Bio-Resource, Wenzhou 325005, China

Abstract: The predictability of high temperatures is important for intertidal species for coping with thermal stress. To investigate the roles of high temperature and its predictability on the population abundance and reproductive output of an intertidal rocky shore limpet, Siphonaria japonica, we monitored the operative temperature, recorded the population abundance of egg ribbons and adults, and quantified the expression of heat shock protein 70 (hsp70) mRNA on two warm-temperate rocky shores with different thermal environments. Abundances of limpets and egg ribbons in the hotter but more predictable (HP) habitats were higher than those in the relatively benign and unpredictable (BU) habitats. In the HP habitats, there was a strong positive correlation between habitat temperature and population abundance. For limpets living in the HP habitats, the expression of hsp70 exhibited a smaller increase with rising body temperature than for BU limpets, indicating the existence in HP limpets of a preparatory strategy in cellular stress response against thermal stress. Our results demonstrate that the predictability of operative temperature can affect physiological responses and population dynamics. The importance of predictability should be considered in analyses of the ecological consequences of climate warming.

    HTML

Introduction
  • The mean temperature and the frequency of extreme thermal events are both projected to increase because of global change (IPCC 2013). Recognizing these challenges to organisms, studies have investigated the ecological impacts of both changing average environmental conditions and stochastic temperature variation beyond the mean (Dillon et al. 2016; Harris et al. 2018; Koenig and Liebhold 2016; Nadeau et al. 2017; Vasseur et al. 2014; Vázquez et al. 2017). Furthermore, environmental predictability may decrease with global change, and there is growing recognition that environmental predictability can play important roles in affecting the structure and function of ecosystems (Burgess and Marshall 2014; Dong et al. 2017; Drake et al. 2017; Helmuth et al. 2006; Nadeau et al. 2017; van der Bolt et al. 2018). Extreme heating events will reduce the predictability of temperature, which could lead to mass mortalities of organisms (Denny et al. 2009; Firth and Williams 2009; Harley 2008). Therefore, it is important to understand the effect of thermal predictability on population dynamics in the face of increasing mean temperature and higher uncertainty of thermal conditions.

    The unpredictable nature of temperature fluctuations over tidal cycles may influence the thermal tolerance of intertidal species (Denny et al. 2009; Denny and Dowd 2012). For example, there are significant differences in thermal tolerance of the intertidal limpet Lottia digitalis between unpredictable trials with different heating patterns, suggesting that unpredictability modulates small adjustments in upper temperature tolerance (Drake et al. 2017). Temporal autocorrelation analyses have also indicated that the effectiveness of behavioral thermoregulation of intertidal snails was potentially lowest at sites where the thermal environments had the lowest thermal predictability and the most extreme temperatures (Dong et al. 2017).

    Given that climate change is occurring at an unprecedented rate, it is essential to understand the underlying mechanisms that define an organism's capacity to cope with these changes and its ability to tolerate future changes in absolute temperature (i.e., temperatures novel from those experienced in the past), thermal variation, and thermal predictability (Hofmann and Todgham 2010; Pörtner and Farrell 2008; Somero 2012; Somero et al. 2017). Heat shock response (HSR) is an adaptation to biotic and abiotic stressors that cause damage to proteins (Somero 2020). Being energetically costly, the HSR can potentially lead to tradeoffs between energy requirements for maintenance and those associated with growth, development, and reproduction (Feder and Hofmann 1999; Sokolova et al. 2012). Differences in the capacity to induce cellular defense or protective mechanisms upon heating might result in differences in upper thermal tolerance (Brown et al. 2002; Dong et al. 2015; Tomanek and Zuzow 2010). For example, congeneric limpets of the genus Lottia exhibited different levels of heat shock protein induction under heat stress conditions (Dong et al. 2008). The high intertidal species Lottia scabra maintains high constitutive levels of HSPs and is thereby prepared for stress from high temperature, which is common in its habitat. In contrast, the mid- and low-intertidal species L. austrodigitalis, L. scutum, and L. pelta rely more on inducing HSPs when exposed to elevated temperatures (Dong et al. 2008). Studies have also revealed rhythmic gene expression in the sessile species Mytilus californianus under unpredictable heating conditions related to tidal cycle, and the elevated expression of protein-folding genes acts as a preparative or protective function in animals inhabiting the high intertidal zone (Connor and Gracey 2011; Gracey et al. 2008). However, few studies have considered the mechanistic strategies of HSR expression under natural unpredictable heating conditions (Drake et al. 2017).

    The limpet Siphonaria japonica (Donovan, 1824) is a pulmonate gastropod found in the middle intertidal zone on rocky shores. The geographic distribution of this subtropical species ranges from northern Japan (Hokkaido at ~ 42° N) to southern China (Hainan at ~ 20° N) (Dayrat et al. 2014). It is a hermaphroditic species with planktotrophic development (Abe 1940). Studies have been conducted on diverse aspects of its reproductive biology, including its spawning season, behavior, potential fecundity, embryonic and larval development, and growth and settlement (Abe 1940; Hirano and Inaba 1980; Hirano 1980; Liu 1994; Wang et al. 2017). Distribution and population dynamics of S. japonica have been examined on rocky intertidal shores in Hong Kong by Liu (1994). Environmental temperature can affect growth, survival, development, and reproduction of this species and there are different thermal tolerance limits among different life history stages (Wang et al. 2017). In the present study, we assessed if limpet populations exhibited unique characteristics in two distinct thermal environments, one hotter and more predictable and the other relatively benign and unpredictable. In doing so, we recognize differences in population abundance, reproductive output, and the expression of heat shock protein 70 (hsp70) mRNA under different thermal conditions. This study provides novel information on the effects of predictability of temperature on this limpet and illustrates the importance of evaluating ecological impacts of the increased unpredictability of heating events that may result from ongoing climate change.

Results

    Daily extreme operative temperatures

  • The daily extreme operative temperatures experienced in the field by limpets, gradually increased on both shores from March to June 2013 (Fig. 1a). The daily extreme operative temperatures were significantly different between the two shores (paired-samples t test, t = 4.20, df = 89, P < 0.01), revealing that the northwest-facing shore was a hotter habitat than the southeast-facing shore. During the survey period of 90 days, daily extreme operative temperatures beyond 34 ℃ occurred on 12 days (accounting for 13.3%) in the hotter habitat, but none was observed in the benign habitat (Fig. 1b). Temporal autocorrelation analysis showed that the daily extreme operative temperatures were more predictable (greater temporal autocorrelation) on the northwest-facing shore than that on the southeast-facing shore (Fig. 1c). Therefore, the in situ operative temperature data suggested that there were two thermal environments: the hotter and more predictable (HP) habitat on the northwest-facing shore and the relatively benign and unpredictable (BU) habitat on the southeast-facing shore.

    Figure 1.  Daily operative temperatures of Siphonaria japonica from March 2013 to June 2013 at study sites. a The 99th percentile of daily operative temperatures in the hot and predictable habitats (HP) (red line) and the relative benign and unpredictable habitat (BU) (blue line). Relative frequencies of daily extreme operative temperature in the HP habitat (b) and BU habitat (c). d Autocorrelation of daily extreme operative temperatures in the HP and BU habitats

  • Adult limpet and egg ribbon abundances

  • Abundance of adult limpets gradually decreased (nested ANOVA, F = 4.86, df = 10, P < 0.01, Table 1) from March 24th 2013 (mean±SEM: HP habitat, 117 ±34/m2; BU habitat, 94±39/m2) to June 18th 2013 (HP habitat, 9±3/m2; BU habitat, 28 ±13/m2) (Fig. 2a). There was a significant difference in abundance between habitats within sampling occasions (nested ANOVA, F = 1.86, df = 11, P = 0.04, Table 1).

    df SS MS F P
    Adult limpet density
      Among sampling occasions 10 1487.38 148.74 4.86 < 0.01
      Among habitats within sampling occasions 11 625.03 56.82 1.86 0.04
      Within habitat 308 9422.30 30.60
      Total 330 28016.00
    Egg ribbon density
      Among sampling occasions 10 4939.24 493.92 15.35 < 0.01
      Among habitats within sampling occasions 11 1429.75 129.98 4.04 < 0.01
      Within habitat 308 9907.95 32.17
      Total 330 21152.00
    Number of egg ribbons per limpet
      Among sampling occasions 10 197.07 19.71 13.97 < 0.01
      Among habitats within sampling occasions 11 118.75 10.80 7.65 < 0.01
      Within habitat 308 434.43 1.41
      Total 330 851.71

    Table 1.  Two-factor nested ANOVA to test for variation in the abundance of adult limpets and egg ribbons and the number of egg ribbons per limpet among sampling occasions and among habitats within each sampling occasion

    There were significant changes of egg ribbon density among sampling occasions (nested ANOVA, F = 15.35, df = 10, P < 0.01, Table 1). Abundance of egg ribbons initially rose in early April, reached maximum values in the middle of May (mean±SEM: HP habitat, 446±121/m2; BU habitat, 123 ± 55/m2), and disappeared in June. There was a significant difference in egg ribbon density between habitats within sampling occasions (nested ANOVA, F = 4.04, df = 11, P < 0.01, Table 1). The numbers of egg ribbons per limpet among sampling occasions (nested ANOVA, F = 13.97, df = 10, P < 0.01, Table 1; Fig. 2b) and between habitats within sampling occasions (nested ANOVA, F = 7.65, df = 11, P < 0.01, Table 1) were significantly different.

    Figure 2.  Population dynamics of Siphonaria japonica in the hot and predictable (HP) (circle) and benign and unpredictable (BU) (triangle) habitats at study sites in Dongtou, China. a Adult limpet density. b The number of egg ribbons per limpet. c Shell length of adult limpets. Values are reported as mean±SEM. There are significant differences in adult density, the number of egg ribbons per limpet, and shell length between habitats based on nested ANOVA. Asterisk indicates significant difference (P < 0.05) between HP and BU habitats at the same date

    The mean body size was significantly smaller in the HP habitat than in the BU habitat in the most field surveys (Fig. 2c). When pooling all shell length data collected from all sampling occasions from each shore, the mean shell length (± SEM) of limpets in the HP habitat (8.08 ± 0.06 mm) was significantly lower than those in the BU habitat (9.13 ± 0.07 mm) (t test, t = 11.22, df = 1250, P < 0.05).

    To evaluate effects of in situ real-time temperatures on population density, we conducted GLM analyses with a negative binomial distribution. It showed that population density significantly decreased with habitat temperature increase (GLMNB, P < 0.01, Table 2; Fig. 3). Population densities between two habitats were significantly different (P < 0.01, Table 2), with population density declining more rapidly in the HP habitat. No significant interaction of temperature and habitat on population density was found (P = 0.32).

    Predictors df Deviance Residential df Residential deviance P
    Temperature 1 30.73 313 541.93 2.96e−08***
    Habitat 1 24.47 312 517.46 7.57e−07***
    Temperature:habitat 1 0.99 311 516.47 0.32
    Negative binomial overdispersion parameter: φ = 25.37 (Siphonaria japonica)
    Three asterisks indicate P < 0.01

    Table 2.  Negative binomial generalized linear model (NBGLM) analysis of deviance of the effects of temperatures and habitats on the numbers of individuals of Siphonaria japonica

    Figure 3.  The relationship between population density of Siphonaria japonica and in situ real-time temperatures in the hot and predictable (HP) habitats (a) and the benign and unpredictable (BU) habitats (b).

  • Expression of hsp70 mRNA

  • There was no significant difference in expression of hsp70 mRNA between the two habitats (t test, t = − 0.04, df = 99, P = 0.94). Levels of hsp70 expression increased with onshore body temperature increase (GLM, χ2 = 219.92, P < 0.01, Table 3), and differed between two habitats (χ2 = 17.61, P < 0.01) (Fig. 4). There was no significant interaction between body temperature and habitat (χ2=1.56, P = 0.21). GLM analysis suggested that changes in hsp70 expression per unit change in body temperature were higher in BU than in HP habitats.

    df χ2 P
    Body temperature 1 219.92 < 2.20e−16***
    Habitat 1 17.61 2.72e−05***
    Habitat×body temperature 1 1.56 0.21
    Three asterisks indicate P < 0.01

    Table 3.  Analysis of deviance for generalized linear model (GLM) with gamma error distribution, to investigate the effects of habitats and on-shore body temperatures on the relative mRNA expressions of hsp70

    Figure 4.  On-shore relative mRNA expression of hsp70 of Siphonaria japonica at various body temperatures in the hot and predictable (HP) (circle) and benign and unpredictable (BU) (triangle) habitats. Lines represent best-fitting GLM models with a gamma error distribution, and shaded regions represent 95% confidence intervals. Red and blue lines represent data from HP and BU habitats, respectively

Discussion
  • The predictability of environmental temperature is an important environmental variable affecting population dynamics on rocky intertidal shores. Our in situ operative temperature data reveal divergent thermal environments (hot vs. benign and predictable vs. unpredictable) between the two study shores. Combined analyses of in situ operative temperatures, field ecological surveys, and stress protein expression show that there are differences in abundance, reproduction, and thermal sensitivity of HSP expression between populations of S. japonica inhabiting shores with different predictability of environmental temperature.

    A strong correlation between variability of habitat temperature and the abundance of adult limpets exists, indicating that the predictability of operative temperature is important for survival of S. japonica. Recent research indicates that elevated temporal autocorrelation in temperature under future climate warming will either increase or decrease the risk of population extinction depending on the strength of environmental fluctuations and the sensitivity of population dynamics to these fluctuations (Di Cecco and Gouhier 2018; Schwager et al. 2006). As indicated by GLM analyses, population densities between two habitats were significantly different, and population density declined more rapidly in the HP habitat, suggesting that population dynamics are more sensitive to increasing temperature in the HP habitat, and such a population might experience elevated extinction risk under climate change. The seasonal decreases in density of limpets might be due to down-shore migration out of the survey areas or large-scale mortality in the face of high temperature.

    The predictability of extreme operative temperature also impacts spawning and egg ribbon abundance of S. japonica. Limpets inhabiting conditions with higher predictability of temperature would produce more egg ribbons per limpet under preferred temperature conditions and stop spawning before extreme thermal stress occurs. Environmental predictability has an important effect on the parental and offspring fitness (Burgess and Marshall 2014; Nadeau et al. 2017; Tonkin et al. 2017; Varpe 2017). For example, Shama (2015) found that both temperature and environmental predictability can affect reproductive output traits of a marine stickleback Gasterosteus aculeatus, with smaller but more eggs produced by adults that developed under the extreme and predictable condition. In unpredictable environments, organisms prefer to produce offspring with different phenotypes or oviposit in different microclimates to spread their risk in unknown future conditions (Botero et al. 2015; Cohen 1966; Nadeau et al. 2017; Tufto 2015). The predictability of seasonality impacts life history trade-offs among growth, storage, and reproduction (Varpe 2017), and the energy allocation between them has important fitness consequences (Ejsmond et al. 2010; Houston and McNamara 1999; Reznick and Braun 1987). Parents in good physiological condition are able to reproduce earlier and produce higher quality offspring (Daan and Tinbergen 1997). Considering that thermal stress over 34.5 ℃ could lead to low hatching success of S. japonica (Wang et al. 2017), limpets may possibly produce more egg ribbons before extreme high temperature occurs in the predictable thermal circumstance. This could then lead to protection of offspring from exposure to subsequent extreme thermal stress and improve hatching success. However, differentiation in reproductive output needs to be interpreted with caution, as food availability can affect growth and body size (Liu 1994) that, in turn, can affect energy allocation strategy under different thermal conditions. Therefore, to validate our findings, future studies might include measures of food availability, the size of egg ribbons, and egg numbers.

    The cellular stress response (hsp70 gene expression) to temperature is different in limpets inhabiting thermal environments with different predictability. The limpet Lottia digitalis could maintain a high upper thermal tolerance under predictable conditions and the difference in upper temperature tolerance might be related to differences in the capacity to induce cellular defense or protective mechanisms (e.g., expression of heat shock proteins) (Drake et al. 2017). Limpets in the HP habitat show a relatively low induction of hsp70 mRNA with rising temperature, indicating that they potentially adopt a "preparatory" strategy involving higher constitutive HSP production to cope with higher thermal stress (Dong et al. 2008). The more extensive upregulation of hsp70 mRNA in limpets in the BU habitat indicates more energy is allocated into cellular homeostasis during heat stress, which might reduce energy available for ensuring reproductive output (i.e., lead to lower abundance of egg ribbons).

    In conclusion, predictable versus unpredictable environments contribute to differences in physiological response to heat stress and population abundance of the limpet S. japonica in the field. In a scenario of climate warming that includes both an increase of extreme heating events and a decrease in environmental temperature predictability, there could be sufficient reductions in thermal tolerance and reproductive output to lead to an increased risk of population extinction and, thereby, to reductions in a species' distribution ranges.

Materials and methods

    In situ operative temperature measurement

  • Biomimetic loggers (Robolimpets) were used to monitor operative temperatures of limpets, according to the method used by Lima and Wethey (2009), on Dongtou Isle, Zhejiang, China (121°10′ N, 27°51′ E; Fig. 5a). Six robolimpets were deployed on Marth 24th 2013 in the middle intertidal zone across heights that covered the main vertical distribution range of Siphonaria japonica (between 2.5 m and 5.5 m above chart datum), on two shores (northwest facing and southeast facing) in the same bay (three robolimpets on each shore). Loggers recorded temperature every 30 min, with a resolution of 0.06 ℃. During the experiment, damaged or broken Robolimpets were replaced with new ones at the same position, and temperature data were collected every seven days in case of loss of the robolimpets.

    Figure 5.  Study sites in the southeast-facing and northwest-facing shores, Dongtou Island, Zhejiang, China (a). Spawning of Siphonaria japonica with egg ribbons laid on the rocks (b) and investigation of the abundance of limpets and egg ribbons (c) in the field

    The daily extreme operative temperature was obtained from the 99th percentile value for each day, taken from the pooled temperatures for all three loggers at a site (Helmuth et al. 2002). Daily extreme operative temperatures were transformed using the reciprocal transformation in case of heterogeneity, and then a paired-samples t test was used to compare the two groups of temperature using SPSS v22.00 with α = 0.05 (IBM Corp, NY, USA).

    To examine the temporal patterns of stressful operative temperature on each shore, a temporal autocorrelation analysis was performed with 'acf' function in the stats package in R v3.5 (R Core Team 2014), according to the method by Helmuth et al. (2006). Temporal autocorrelation reflects the relationship between successive observations (lags) in a time series, i.e., the degree to which historical thermal conditions on one day affect future thermal conditions at different lag times. The autocorrelation in daily extreme temperatures on both shores was calculated for lag periods varying from one day to 14 days.

  • Density and sizes of adult limpets and egg ribbons

  • Abundances of adult limpets and egg ribbons were recorded during daytime low tides approximately weekly from March to June 2013 (11 sampling occasions on each shore). A 5-m-wide transect parallel to the sea was established on each shore, and investigations were carried out from 2.5 to 5.5 m above chart datum. A total of 15 100-point doublestrung quadrats (25 × 25 cm) were placed randomly along each shore. Within each quadrat, the numbers of limpets and egg ribbons of S. japonica were counted. The body size of all limpets was measured with a vernier caliper (0.05 mm), and rock surface temperature where the quadrat was placed was recorded as the real-time temperature.

    Because our data were over-dispersed count data with a large number of zeros, which may impede accurate data analysis when using parametric variance analysis and nonparametric Friedman methods, the relationship between the abundance of limpets and environmental factors (real-time temperature and shore) was assessed using a generalized linear model (GLM) fitted with a negative binomial distribution (GLMNB) in R v3.5 (R Core Team 2014) with MASS package (generalized linear model "glm.nb") (Venables and Ripley 2002). The model was fitted using both factors (realtime temperature and shore) with two-way interaction and both factors without interaction respectively, and then the model with the lowest Akaike information criterion (AIC) value was selected.

    Abundance data were square root transformed before statistical analyses to improve homogeneity of variances. A two-factor nested ANOVA (shores nested within sampling occasions) was used to analyze temporal variation in the abundance of adult limpets and egg ribbons and the number of egg ribbons per limpet using SPSS v22.00 with α = 0.05 (IBM Corp, NY, USA). Bonferroni-corrected alpha levels were used to assess the significance of ANOVA results.

  • Tissue sampling and hsp70 gene expression measurement

  • Approximately 10 individuals (>8 mm in shell length) were collected on each shore during spring low tides (at two-week intervals) from March to June 2013. The sampling area was at least 10 m away from the area used for the abundance investigation. Collections were conducted within 40 min of low tide, to minimize possible physiological variations related to endogenous tidal rhythms (Tomanek and Sanford 2003). The body temperature of individuals was measured with a thermocouple inserted underneath the foot. After body temperature measurement, each limpet was immediately dissected, and the foot muscle was cut into small pieces (~ 0.1 cm2); these were then placed into a 1.5 ml microtube containing 0.5 ml microtube containing RNAlater® solution (Ambion, Applied Biosystems, Austin, USA). Samples were kept at 4 ℃ for ~ 12 h to allow the RNAlater to permeate tissues and stabilize the RNA (Hillyard and Clark 2012) and then were stored at − 80 ℃ until further processing.

    Total RNA was extracted from~50 mg of foot muscle for each individual sample using Eastep Reagent Kit following the protocol provided by the manufacturer (Promega, Madison, WI, USA) and quantified using a NanoDrop ND-2000 photometer (Thermo Fisher Scientific, Waltham, MA, USA). Synthesis of cDNA was conducted using total RNA (~5 μg) by reverse transcriptase (RT) reactions with a PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Shiga, Japan). We quantified the mRNA expression level of heat shock protein 70 (hsp70) gene using SYBR Green quantitative PCR following the manufacturer's protocol (Bio-Rad Laboratories, Inc., Hercules, CA, USA). For the normalization of hsp70 gene expression, three genes (18S ribosomal RNA, β-actin, and β-tubulin) which usually have relatively stable expression levels were selected as reference genes, and their expression levels were evaluated based on the expression stability measures (M values) as described by Etschmann et al. (2006). The partial sequences of these four genes were cloned (GenBank accessions: 18S, KX529884; β-actin, KX529885; β-tubulin, KX529886; hsp70, KX529887) and used to design the real-time PCR primers (Table 4) with Beacon Designer 7 software (Premier Biosoft International, Palo Alto, CA, USA). The amplification efficiency of each primer set was assessed by real-time PCR prior to sample analyses. All samples were analyzed in triplicate. Ct (dR) values were calculated with the Bio-Rad CFX Manager™ Software v3.0. Finally, the expression level of hsp70 mRNA was determined relative to the value of three reference genes from a reference individual.

    Gene name Gene symbol Function Primers (5′–3′)
    Heat shock protein 70 hsp70 Molecular chaperone F: CGTTGCTCCTCTGTCTCTTG
    R: GTCATTGCTCGTTCTCCTTCATA
    Beta actin β-actin Reference gene F: ACCACCTACAACTCCATCAT
    R: GCATTCTGTCAGCAATACCA
    Tubulin beta chain β-tubulin Reference gene F: AGAACAAGAACTCATCCTACT
    R: TTACGCCTGAACATAGCA
    18S ribosomal RNA 18S Reference gene F: TTAGCCACACGAGATTGAG
    R: CATCCACGCTGATTCCTT

    Table 4.  Functions and primers of selected genes

    To examine the effects of on-shore body temperature and shore on the expression levels of hsp70 gene, a generalized linear model fitted with a gamma error distribution was employed, using R v3.5 with MASS package following Han et al. (2019). A logistic link function was used in the gamma error distribution. On-shore body temperature, shore, and their interactions were used as explanatory variables.

  • Acknowledgements

  • The study was support by National Natural Science Foundation of China (nos. 41776135, 41976142). Nature Science funds for Distinguished Young Scholars of Fujian Province, China (no. 2017J07003).

  • Author contributions

  • JW and YWD: conceived and designed the study; JW and XP: conducted the field surveys; JW: conducted heat shock protein quantification and other data analysis. All the authors contributed to manuscript writing and approved the final version for submission.

Compliance with ethical standards

    Conflict of interest

  • The authors declare that they have no conflict of interest.

  • Animal and human rights statement

  • We declare that all applicable international, national, and/or institutional guidelines for sampling, care, and experimental use of organisms for the study have been followed and all necessary approvals have been obtained.

Reference (55)

Catalog

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return