+Advanced Search
Volume 2 Issue 4
Nov.  2020
Article Contents

Citation:

Identification, expression analysis, and functional characterization of ghrelin and its receptors in spotted sea bass (Lateolabrax maculatus)

  • Ghrelin (Ghrl), an appetite-inducing peptide hormone secreted by the stomach, is the endogenous ligand for the growth hormone secretagogue receptor (Ghs-r). In this study, we identified the preproghrelin gene and its receptors in spotted sea bass (Lateolabrax maculatus). The ghrl gene consisted of an open reading frame (ORF) of 324 nucleotides encoding 107 amino acids, and the premature protein contained a 20-amino-acid mature peptide. Through a syntenic analysis, we also validated the annotation of growth hormone secretagogue receptor 1a (ghs-r1a) and growth hormone secretagogue receptor 1a-like (ghs-r1a-like), which contained seven-transmembrane structures, in spotted sea bass. The ORF of ghs-r1a consisted of 1152 bp that encoded a 383-amino-acid protein, and ghs-r1a-like contained an ORF of 2631 bp and produced a protein with 876 amino acids. A phylogenetic analysis showed that spotted sea bass ghrl and its receptors clustered with those of other fishes and were more distantly related to those of other vertebrates. In situ hybridization revealed that ghrl was highly expressed in the stomach and localized in the mucosa and submucosa. The expression of these genes varied during short-term starvation in a time-dependent manner. In vitro studies showed that after incubation with Ghrl for 3 h enhanced the expression of motilin (mln), gastrin (gas) and cholecystokinin (cck), but this effect vanished after 6 h of incubation. In summary, Ghrl and its receptors might play important roles in the regulation of food intake in spotted sea bass.
  • 加载中
  • Amole N, Unniappan S (2009) Fasting induces preproghrelin mRNA expression in the brain and gut of zebrafish, Danio rerio. Gen Comp Endocrinol 161:133-137 doi: 10.1016/j.ygcen.2008.11.002
    Barazzoni R, Bosutti A, Stebel M, Cattin MR, Roder E, Visintin L, Cattin L, Biolo G, Zanetti M, Guarnieri G (2005) Ghrelin regulates mitochondrial-lipid metabolism gene expression and tissue fat distribution in liver and skeletal muscle. Am J Physiol Endocrinol Metab 288:E228-E235 doi: 10.1152/ajpendo.00115.2004
    Beck B, Richy S, Stricker-Krongrad A (2003) Ghrelin and body weight regulation in the obese Zucker rat in relation to feeding state and dark/light cycle. Exp Biol Med 228:1124-1131 doi: 10.1177/153537020322801005
    Chan CB, Cheng CHK (2004) Identification and functional characterization of two alternatively spliced growth hormone secretagogue receptor transcripts from the pituitary of black seabream Acanthopagrus schlegeli. Mol Cell Endocrinol 214:81-95 doi: 10.1016/j.mce.2003.11.020
    Date Y, Toshinai K, Koda S, Miyazato M, Shimbara T, Tsuruta T, Niijima A, Kangawa K, Nakazato M (2005) Peripheral interaction of ghrelin with cholecystokinin on feeding regulation. Endocrinology 146:3518-3525 doi: 10.1210/en.2004-1240
    Dornonville de la Cour C, Lindström E, Norlén P, Håkanson R (2004) Ghrelin stimulates gastric emptying but is without effect on acid secretion and gastric endocrine cells. Regul Pept 120:23-32 doi: 10.1016/j.regpep.2004.02.008
    Druce MR, Wren AM, Park AJ, Milton JE, Patterson M, Frost G, Ghatei MA, Small C, Bloom SR (2005) Ghrelin increases food intake in obese as well as lean subjects. Int J Obes 29:1130-1136 doi: 10.1038/sj.ijo.0803001
    Feng K, Zhang GR, Wei KJ, Xiong BX (2013) Molecular cloning, tissue distribution, and ontogenetic expression of ghrelin and regulation of expression by fasting and refeeding in the grass carp (Ctenopharyngodon idellus). J Exp Zool 319:202-212 doi: 10.1002/jez.1784
    Filigheddu N, Gnocchi VF, Coscia M, Cappelli M, Porporato PE, Taulli R, Traini S, Baldanzi G, Chianale F, Cutrupi S, Arnoletti E, Ghè C, Fubini A, Surico N, Sinigaglia F, Ponzetto C, Muccioli G, Crepaldi T, Graziani A (2007) Ghrelin and des-acyl ghrelin promote differentiation and fusion of C2C12 skeletal muscle cells. Mol Biol Cell 18:986-994 doi: 10.1091/mbc.e06-05-0402
    Gué M, Buéno L (1996) Brain-gut interaction. Semin Neurol 16:235-243 doi: 10.1055/s-2008-1040980
    Hevrøy EM, Azpeleta C, Shimizu M, Lanzén A, Kaiya H, Espe M, Olsvik PA (2011) Effects of short-term starvation on ghrelin, GH-IGF system, and IGF-binding proteins in Atlantic salmon. Fish Physiol Biochem 37:217-232 doi: 10.1007/s10695-010-9434-3
    Howard AD, Feighner SD, Cully DF, Arena JP, Liberator PA, Rosenblum CI, Hamelin M, Hreniuk DL, Palyha OC, Anderson J, Paress PS, Diaz C, Chou M, Liu KK, McKee KK, Pong SS, Chaung LY, Elbrecht A, Dashkevicz M, Heavens R et al (1996) A receptor in pituitary and hypothalamus that functions in growth hormone release. Science 273:974-977 doi: 10.1126/science.273.5277.974
    Huda MSB, Dovey T, Wong SP, English PJ, Halford J, McCulloch P, Cleator J, Martin B, Cashen J, Hayden K, Wilding JPH, Pinkney J (2009) Ghrelin restores 'lean-type' hunger and energy expenditure profiles in morbidly obese subjects but has no effect on postgastrectomy subjects. Int J Obes 33:317-325 doi: 10.1038/ijo.2008.270
    Inui A, Asakawa A, Bowers CY, Mantovani G, Laviano A, Meguid MM, Fujimiya M (2004) Ghrelin, appetite, and gastric motility: the emerging role of the stomach as an endocrine organ. Faseb J 18:439-456 doi: 10.1096/fj.03-0641rev
    Jönsson E, Forsman A, Einarsdottir IE, Kaiya H, Ruohonen K, Björnsson BT (2007) Plasma ghrelin levels in rainbow trout in response to fasting, feeding and food composition, and effects of ghrelin on voluntary food intake. Comp Biochem Physiol A Mol Integr Physiol 147:1116-1124 doi: 10.1016/j.cbpa.2007.03.024
    Kaiya H, Kangawa K, Miyazato M (2013) Ghrelin receptors in non-Mammalian vertebrates. Front Endocrinol 4:81 
    Kaiya H, Kangawa K, Miyazato M (2014) Molecular evolution of GPCRs: Ghrelin/ghrelin receptors. J Mol Endocrinol 52:87-100 
    Kaiya H, Kojima M, Hosoda H, Moriyama S, Takahashi A, Kawauchi H, Kangawa K (2003a) Peptide purification, complementary deoxyribonucleic acid (DNA) and genomic DNA cloning, and functional characterization of ghrelin in rainbow trout. Endocrinology 144:5215-5226 doi: 10.1210/en.2003-1085
    Kaiya H, Kojima M, Hosoda H, Riley LG, Hirano T, Grau EG, Kangawa K (2003b) Amidated fish ghrelin: purification, cDNA cloning in the Japanese eel and its biological activity. J Endocrinol 176:415-423 doi: 10.1677/joe.0.1760415
    Kaiya H, Miura T, Matsuda K, Miyazato M, Kangawa K (2010) Two functional growth hormone secretagogue receptor (ghrelin receptor) type 1a and 2a in goldfish, Carassius auratus. Mol Cell Endocrinol 327:25-39 doi: 10.1016/j.mce.2010.06.004
    Kaiya H, Mori T, Miyazato M, Kangawa K (2009) Ghrelin receptor (GHS-R)-like receptor and its genomic organisation in rainbow trout, Oncorhynchus mykiss. Comp Biochem Physiol A Mol Integr Physiol 153:438-450 doi: 10.1016/j.cbpa.2009.04.612
    Kaiya H, Small BC, Bilodeau AL, Shepherd BS, Kojima M, Hosoda H, Kangawa K (2005) Purification, cDNA cloning, and characterization of ghrelin in channel catfish, Ictalurus punctatus. Gen Comp Endocrinol 143:201-210 doi: 10.1016/j.ygcen.2005.03.012
    Katayama M, Nogami H, Nishiyama J, Kawase T, Kawamura K (2000) Developmentally and regionally regulated expression of growth hormone secretagogue receptor mRNA in rat brain and pituitary gland. Neuroendocrinology 72:333-340 doi: 10.1159/000054602
    Kato K, Himeno S, Takahashi Y, Wakabayashi T, Tarui S, Matsubara K (1983) Molecular cloning of human gastrin precursor cDNA. Gene 26:53-57 doi: 10.1016/0378-1119(83)90035-5
    Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K (1999) Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402:656-660 doi: 10.1038/45230
    Layer P, Chan AT, Go VL, DiMagno EP (1988) Human pancreatic secretion during phase Ⅱ antral motility of the interdigestive cycle. Am J Physiol 254:G249-G253 
    Lee HM, Wang G, Englander EW, Kojima M, Greeley GH Jr (2002) Ghrelin, a new gastrointestinal endocrine peptide that stimulates insulin secretion: enteric distribution, ontogeny, influence of endocrine, and dietary manipulations. Endocrinology 143:185-190 doi: 10.1210/endo.143.1.8602
    McCaleb ML, Myers RD (1980) Cholecystokinin acts on the hypothalamic "noradrenergic system" involved in feeding. Peptides 1:47-49 doi: 10.1016/0196-9781(80)90034-0
    Muccioli G, Papotti M, Locatelli V, Ghigo E, Deghenghi R (2001) Binding of 125I-labeled ghrelin to membranes from human hypothalamus and pituitary gland. J Endocrinol Invest 24:C7-C9 doi: 10.1007/BF03343831
    Murakami N, Hayashida T, Kuroiwa T, Nakahara K, Ida T, Mondal MS, Nakazato M, Kojima M, Kangawa K (2002) Role for central ghrelin in food intake and secretion profile of stomach ghrelin in rats. J Endocrinol 174:283-288 doi: 10.1677/joe.0.1740283
    Murashita K, Kurokawa T, Nilsen TO, Rønnestad I (2009) Ghrelin, cholecystokinin, and peptide YY in Atlantic salmon (Salmo salar): molecular cloning and tissue expression. Gen Comp Endocrinol 160:223-235 doi: 10.1016/j.ygcen.2008.11.024
    Ohno T, Mochiki E, Kuwano H (2010) The roles of motilin and ghrelin in gastrointestinal motility. Int J Pept 2010:820794 
    Olsson C, Holbrook JD, Bompadre G, Jönsson E, Hoyle CHV, Sanger GJ, Holmgren S, Andrews PLR (2008) Identification of genes for the ghrelin and motilin receptors and a novel related gene in fish, and stimulation of intestinal motility in zebrafish (Danio rerio) by ghrelin and motilin. Gen Comp Endocrinol 155:217-226 doi: 10.1016/j.ygcen.2007.05.016
    Parhar IS, Sato H, Sakuma Y (2003) Ghrelin gene in cichlid fish is modulated by sex and development. Biochem Biophys Res Commun 305:169-175 doi: 10.1016/S0006-291X(03)00729-0
    Petersenn S (2002) Structure and regulation of the growth hormone secretagogue receptor. Minerva Endocrinol 27:243-256 
    Porporato PE, Filigheddu N, Reano S, Ferrara M, Angelino E, Gnocchi VF, Prodam F, Ronchi G, Fagoonee S, Fornaro M, Chianale F, Baldanzi G, Surico N, Sinigaglia F, Perroteau I, Smith RG, Sun Y, Geuna S, Graziani A (2013) Acylated and unacylated ghrelin impair skeletal muscle atrophy in mice. J Clin Invest 123:611-622 
    Rehfeld JF (2006) The endoproteolytic maturation of progastrin and procholecystokinin. J Mol Med 84:544-550 doi: 10.1007/s00109-006-0055-3
    Sakata I, Mori T, Kaiya H, Yamazaki M, Kangawa K, Inoue K, Sakai T (2004) Localization of ghrelin-producing cells in the stomach of the rainbow trout (Oncorhynchus mykiss). Zoolog Sci 21:757-762 doi: 10.2108/zsj.21.757
    Sato T, Nakamura Y, Shiimura Y, Ohgusu H, Kangawa K, Kojima M (2011) Structure, regulation and function of ghrelin. J Biochem 151:119-128 
    Sheriff S, Kadeer N, Joshi R, Friend LA, James JH, Balasubramaniam A (2012) Des-acyl ghrelin exhibits pro-anabolic and anti-catabolic effects on C2C12 myotubes exposed to cytokines and reduces burn-induced muscle proteolysis in rats. Mol Cell Endocrinol 351:286-295 doi: 10.1016/j.mce.2011.12.021
    Shrestha YB, Wickwire K, Giraudo SQ (2009) Direct effects of nutrients, acetylcholine, CCK, and insulin on ghrelin release from the isolated stomachs of rats. Peptides 30:1187-1191 doi: 10.1016/j.peptides.2009.02.001
    Takaya K, Ariyasu H, Kanamoto N, Iwakura H, Yoshimoto A, Harada M, Mori K, Komatsu Y, Usui T, Shimatsu A, Ogawa Y, Hosoda K, Akamizu T, Kojima M, Kangawa K, Nakao K (2000) Ghrelin strongly stimulates growth hormone release in humans. J Clin Endocrinol Metab 85:4908-4911 doi: 10.1210/jcem.85.12.7167
    Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725-2729 doi: 10.1093/molbev/mst197
    Tanaka M, Miyazaki T, Yamamoto I, Nakai N, Ohta Y, Tsushima N, Wakita M, Shimada K (2003) Molecular characterization of chicken growth hormone secretagogue receptor gene. Gen Comp Endocrinol 134:198-202 doi: 10.1016/S0016-6480(03)00247-8
    Unniappan S, Canosa LF, Peter RE (2004) Orexigenic actions of ghrelin in goldfish: feeding-induced changes in brain and gut mRNA expression and serum levels, and responses to central and peripheral injections. Neuroendocrinology 79:100-108 doi: 10.1159/000076634
    Unniappan S, Lin X, Cervini L, Rivier J, Kaiya H, Kangawa K, Peter RE (2002) Goldfish ghrelin: molecular characterization of the complementary deoxyribonucleic acid, partial gene structure and evidence for its stimulatory role in food intake. Endocrinology 143:4143-4146 doi: 10.1210/en.2002-220644
    Volkoff H (2015) Cloning, tissue distribution and effects of fasting on mRNA expression levels of leptin and ghrelin in red-bellied piranha (Pygocentrus nattereri). Gen Comp Endocrinol 217-218:20-27 doi: 10.1016/j.ygcen.2015.05.004
    Wang H, Wen H, Li Y, Zhang K, Liu Y (2018) Evaluation of potential reference genes for quantitative RT-PCR analysis in spotted sea bass (Lateolabrax maculatus) under normal and salinity stress conditions. PeerJ 6:e5631 doi: 10.7717/peerj.5631
    Wang W, Ma C, Chen W, Zhang H, Kang W, Ni Y, Ma L (2017) Population genetic diversity of Chinese sea bass (Lateolabrax maculatus) from southeast coastal regions of China based on mitochondrial COI gene sequences. Biochem Syst Ecol 71:114-120 doi: 10.1016/j.bse.2017.01.002
    Wren AM, Small CJ, Ward HL, Murphy KG, Dakin CL, Taheri S, Kennedy AR, Roberts GH, Morgan DG, Ghatei MA, Bloom SR (2000) The novel hypothalamic peptide ghrelin stimulates food intake and growth hormone secretion. Endocrinology 141:4325-4328 doi: 10.1210/endo.141.11.7873
    Xu M, Volkoff H (2009) Molecular characterization of ghrelin and gastrin-releasing peptide in Atlantic cod (Gadus morhua): cloning, localization, developmental profile and role in food intake regulation. Gen Comp Endocrinol 160:250-258 doi: 10.1016/j.ygcen.2008.12.004
    Yeung CM, Chan CB, Woo NYS, Cheng CHK (2006) Seabream ghrelin: cDNA cloning, genomic organization and promoter studies. J Endocrinol 189:365-379 doi: 10.1677/joe.1.06593
    Zhang JV, Ren PG, Avsian-Kretchmer O, Luo CW, Rauch R, Klein C, Hsueh AJW (2005) Obestatin, a peptide encoded by the ghrelin gene, opposes ghrelin's effects on food intake. Science 310:996-999 doi: 10.1126/science.1117255
    Zhang X, Wen H, Wang H, Ren Y, Zhao J, Li Y (2017) RNA-Seq analysis of salinity stress-responsive transcriptome in the liver of spotted sea bass (Lateolabrax maculatus). PLoS ONE 12:e0173238 doi: 10.1371/journal.pone.0173238
    Zhou Y, Qi X, Wen H, Zhang K, Zhang X, Li J, Li Y, Fan H (2019) Identification, expression analysis, and functional characterization of motilin and its receptor in spotted sea bass (Lateolabrax maculatus). Gen Comp Endocrinol 277:38-48 doi: 10.1016/j.ygcen.2019.02.013
  • 加载中
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Figures(6) / Tables(2)

Article Metrics

Article views(197) PDF downloads(5) Cited by()

Related
Proportional views

Identification, expression analysis, and functional characterization of ghrelin and its receptors in spotted sea bass (Lateolabrax maculatus)

    Corresponding author: Yun Li, yunli0116@ouc.edu.cn
    Corresponding author: Haishen Wen, wenhaishen@ouc.edu.cn
  • 1. Key Laboratory of Mariculture, Ministry of Education, Ocean University of China, Qingdao 266003

Abstract: Ghrelin (Ghrl), an appetite-inducing peptide hormone secreted by the stomach, is the endogenous ligand for the growth hormone secretagogue receptor (Ghs-r). In this study, we identified the preproghrelin gene and its receptors in spotted sea bass (Lateolabrax maculatus). The ghrl gene consisted of an open reading frame (ORF) of 324 nucleotides encoding 107 amino acids, and the premature protein contained a 20-amino-acid mature peptide. Through a syntenic analysis, we also validated the annotation of growth hormone secretagogue receptor 1a (ghs-r1a) and growth hormone secretagogue receptor 1a-like (ghs-r1a-like), which contained seven-transmembrane structures, in spotted sea bass. The ORF of ghs-r1a consisted of 1152 bp that encoded a 383-amino-acid protein, and ghs-r1a-like contained an ORF of 2631 bp and produced a protein with 876 amino acids. A phylogenetic analysis showed that spotted sea bass ghrl and its receptors clustered with those of other fishes and were more distantly related to those of other vertebrates. In situ hybridization revealed that ghrl was highly expressed in the stomach and localized in the mucosa and submucosa. The expression of these genes varied during short-term starvation in a time-dependent manner. In vitro studies showed that after incubation with Ghrl for 3 h enhanced the expression of motilin (mln), gastrin (gas) and cholecystokinin (cck), but this effect vanished after 6 h of incubation. In summary, Ghrl and its receptors might play important roles in the regulation of food intake in spotted sea bass.

    HTML

Introduction
  • Ghrelin (Ghrl) was first isolated from the stomachs of rats and humans and was identified as an endogenous ligand for the growth hormone secretagogue receptor (Ghs-r), which is a G-protein-coupled receptor with seven transmembrane domains (Kojima et al. 1999). Ghrl is encoded by the preproghrelin gene, which also encodes the 23-amino-acid peptide obestatin, a peptide that can inhibit food intake and counteract the effect of Ghrl (Zhang et al. 2005). In addition to mammals, Ghrl has also been identified in some fishes, including goldfish (Carassius auratus) (Unniappan et al. 2002), eel (Anguilla anguilla) (Kaiya et al. 2003b), channel catfish (Ietalurus punetaus) (Kaiya et al. 2005), and sea bream (Sparus auratus) (Yeung et al. 2006). Ghrl is found in two major forms, n-octanoyl-modified Ghrl and des-acyl Ghrl, which exhibit an n-octanoyl modification on serine-3 and constitute the main source of Ghrl activity (Sato et al. 2011). N-octanoyl-modified Ghrl functions by inducing the release of growth hormone (Takaya et al. 2000) and plays roles in energy expenditure (Huda et al. 2009) and food uptake (Druce et al. 2005). The GHS-R was first identified as the specific receptor for GHRL in mammals (Howard et al. 1996) and has since been identified in several fish species, including zebrafish (Danio rerio) (Olsson et al. 2008), rainbow trout (Oncorhynchus mykiss) (Kaiya et al. 2009), goldfish (Carassius auratus) (Kaiya et al. 2010) and Atlantic salmon (Salmo salar) (Hevrøy et al. 2011). In general, at least two paralogs of Ghs-r exist (Petersenn 2002), and these include Ghs-r1a and Ghs-r1b. Ghs-r1a is active and derives from regular splicing, whereas Ghs-r1b is poorly understood and derives from alternative splicing (Howard et al. 1996). Another paralog named Ghs-r1a-like has only been found in fishes (Kaiya et al. 2013, 2014). Multiple Ghs-r types generally exist in Atlantic salmon (Hevrøy et al. 2011), black sea bream (Acanthopagrus schlegelii) (Chan and Cheng 2004), and zebrafish (Olsson et al. 2008).

    Motilin (Mln), gastrin (Gas) and cholecystokinin (Cck) are gastrointestinal hormones that play vital roles in promoting or inhibiting food intake (Gué and Buéno 1996). Mln, a 22-amino-acid peptide, functions in regulating interdigestive motility, gallbladder contractions, and enzyme secretion in the stomach and pancreas (Layer et al. 1988). Gas is one of the major gastrointestinal hormones and has multiple physiological activities. The most studied activity of Gas is the stimulation of gastric acid secretion while other well-known activities include the activation of gastric movement and the stimulation of pancreatic enzyme secretion (Kato et al. 1983). Cck, a gastrointestinal peptide hormone, has been implicated in the internal mechanism responsible for the termination of eating and the physiological state of satiety (McCaleb and Myers 1980).

    Regulating food intake and the energy balance is essential for ensuring that an organism has sufficient energy to maintain normal growth, survive periods of insufficient food supply, and perform the activities necessary for survival. However, the roles of the Ghrl/Ghs-r system in fish and the associated regulatory mechanisms remain largely unknown. Spotted sea bass (Lateolabrax maculatus) is a popular mariculture fish species in China due to its tastiness and high nutritional value (Wang et al. 2017). To achieve higher economic profits, aquaculture operators control their feed costs by exposing the fish to short-term starvation every few weeks. Ghrl can promote growth hormone secretion and has important functions in regulating food intake and energy balance. The study of ghrl mRNA expression changes during short-term starvation is helpful for understanding its potential function in the regulation of food intake. In this study, we identified Ghrl and its receptors in spotted sea bass, determined their locations, validated the annotation of ghs-r1a and ghs-r1a-like and examined the variation in their expression after short-term starvation. To evaluate the functions of Ghrl, we measured the mRNA expression levels of mln, gas and cck after the in vitro stimulation of cultured stomach fragments with Ghrl. We also explored the application of Ghrl as a food-promoting agent and a growth-promoting agent in the development of the fishery economy.

Results

    Cloning and sequence analysis of ghrl and its receptors

  • The analysis revealed that the ghrl gene of spotted sea bass (MH046053) encodes a Ghrl precursor. In addition, the preproghrelin open reading frame (ORF) consists of 324 nucleotides that encode 107 amino acids, including a 26-amino-acid signal peptide and a 20-amino-acid mature peptide with an acyl-modified Ser at the third position. The alternative splicing of preproghrelin yielded another peptide named "obestatin", which is composed of 23 amino acids (Supplementary Fig. S1A). As shown in Supplementary Fig. S1B, the predicted Ghrl amino acid sequence is highly conserved among teleost species. The first seven amino acids (GSSFLSP) of the mature Ghrl were identical to those in most other species. The mature Ghrl peptide of spotted sea bass shows high sequence homology to the Ghrl peptides of other fish species, including 56.25% homology to the damselfish (Stegastes partitus) Ghrl peptide and 53.13% homology to the Ghrl peptide of large yellow croaker (Larimichthys crocea), but low homology to those of mammalian and poultry species, including 31.25%, 31.25% and 37.50% homology to the human (Homo sapiens), mouse (Mus musculus), and chicken (Gallus gallus) Ghrl peptides, respectively. The analysis also showed that obestatin is highly conserved among fish and vertebrate species, and sea bass obestatin showed 73.91%, 65.22%, 52.17%, 43.48%, 30.43% and 34.78% homology to the obestatin peptides of large yellow croaker (Larimichthys crocea), damselfish (Stegastes partitus), zebrafish (Danio rerio), chicken (Gallus gallus), human (Homo sapiens), and mouse (Mus musculus), respectively.

    The ghs-r1a gene of spotted sea bass (MH046055) has an ORF of 1152 bp, and the predicted protein contains 383 amino acids with seven transmembrane structures (Supplementary Fig. S2). The amino acid sequence of Ghs-r1a displays high sequence homology with the corresponding sequences of other fish species, including 88.57% homology to Ghs-r1a of orange-spotted grouper (Epinephelus coioides), 91.69% homology to Ghs-r1a of large yellow croaker (Larimichthys crocea), 61.30% homology to Ghs-r1a of zebrafish (Danio rerio), 60.52% homology to Ghs-r2a of zebrafish (Danio rerio), but low homology with those of other vertebrate species, e.g., 58.96% homology to chicken (Gallus gallus) Ghs-r1a, 54.29% homology to human (Homo sapiens) Ghs-r1a, 41.30% homology to human (Homo sapiens) Ghs-r1b, and 53.77% homology to rat (Rattus norvegicus) Ghs-r1a (Supplementary Fig. S3). The ghs-r1a-like gene of spotted sea bass (MH046056) includes an ORF of 2631 bp that encodes an 876-amino-acid protein. However, this protein contains eight transmembrane domains (Supplementary Fig. S4) and displays low homology to the corresponding sequences of other species (Supplementary Fig. S5).

  • Syntenic and phylogenetic analysis

  • A syntenic analysis was performed to provide additional support for the annotation of the ghrl receptors. As shown in Fig. 1, the spotted sea bass ghs-r genes shared similar neighboring genes to those of large yellow croaker, although both spotted sea bass and large yellow croaker had unique genes, which were potentially required after their divergence. The two ghs-r genes were derived from the initial whole-genome duplication event (WGD). Overall, the syntenic analysis validated the annotation of the ghs-r genes.

    Figure 1.  Syntenic analysis of spotted sea bass ghs-r genes with those of Larimichthys crocea. a ghs-r1a. b ghs-r1a-like. These syntenies were generated using the information obtained from the genome browser Genomicus

    To analyze the evolutionary relationships of Ghrl and its receptors, a phylogenetic tree was constructed based on the amino acid sequences of these genes in several species (Fig. 2). The results revealed that Ghrl appears to be conserved. The Ghrl of higher vertebrates (human, mouse, monkey, and chicken) and teleosts were grouped into respective lineages in the phylogenetic tree, and the Ghrl of spotted sea bass clustered with its teleost counterparts as expected. Additionally, the clustering pattern provides evidence that spotted sea bass Ghrl shares its highest homology with the Ghrl peptides of European sea bass (Dicentrarchus labrax) and large yellow croaker (Larimichthys crocea). The variants of the ghrl receptor in spotted sea bass were clearly divided into two lineages and share high homology with those of other fishes.

    Figure 2.  Phylogenetic tree of Ghrl and its receptors in spotted sea bass. The phylogenetic trees were constructed using MEGA 6 software based on the maximum likelihood method (The phylogenetic tree constructed by the NJ method has the same clustering effect as the ML method). The red dots indicate the genes encoding Ghrl and its receptors in spotted sea bass

  • Tissue expression of ghrl and its receptors

  • As shown in Fig. 3a, the expression of ghrl was detected in multiple tissues, including pituitary and muscle tissues, and high expression levels were found in the stomach. Both of its receptors were detected in the liver, where high expression levels of ghs-r1a-like were detected (Fig. 3c). The expression of ghs-r1a was also detected in the gonad and pituitary gland, but its expression in the skin, fin and muscle was very low (Fig. 3b).

    Figure 3.  Relative expression levels of the ghrl (a) and ghs-r (b, c) genes in different tissues of spotted sea bass. The fold changes relative to the control are indicated on the y-axis, and the tissues are displayed on the x-axis. The expression levels were quantified by real-time PCR and normalized to the 18S rRNA level

  • In situ hybridization (ISH) of ghrl in spotted sea bass

  • The localization of ghrl mRNA expression in the stomach was tested by ISH. The sense probe was used as a control probe. The sea bass stomach consists of the mucosa (MUC), submucosa (SUB), muscularis (MUSC) and serosa (SER). The MUC is composed of the simple columnar epithelium (SCE), gastric gland (GG), lamina propria (LP) and mucosal muscularis (MM). The hybridization signal of ghrl mRNA in the MUC and SUB was more intense than that of the sense probe (Fig. 4).

    Figure 4.  In situ hybridization-based analysis of the tissue localization of the ghrl gene in the spotted sea bass stomach. Adjacent sections hybridized with the anti-sense (a) and sense (b) probes are shown. Scale bar: 100 μm

  • Changes in gene expression induced by short-term fasting in spotted sea bass stomach

  • To understand the potential functions of Ghrl and its receptors in the stomach, which is a digestive glandular organ, the expression patterns of the genes in spotted sea bass after different fasting times were examined. Fishes sampled at 0 h served as the control. The expression levels of ghrl and its receptors declined gradually after 0 h reaching a minimum at 6 h. The highest expression of ghrl and ghs-r1a-like, which was detected at the 12-h time point, was significantly higher than the corresponding expression level in the control group (P < 0.05), whereas the expression of ghs-r1a in the treated group was consistent with that in the control group. The expression of ghs-r1a and ghs-r1a-like increased continuously from 12 to 72 h (Fig. 5).

    Figure 5.  Effect of different fasting times on the expression of ghrl with the genes encoding its receptors in the stomach. The relative expression levels are shown in the y-axis, and the fasting duration is shown in the x-axis. Significant differences in each gene are noted by different letters (P < 0.05)

  • In vitro actions of spotted sea bass Ghrl on the expression of motilin, gastrin and cholecystokinin mRNAs in stomach fragments

  • To further evaluate the effects of Ghrl on spotted sea bass, an in vitro analysis of the effects of Ghrl on the mRNA expression of mln, gas and cck in stomach fragments was performed. The sequences of ghrl, mln, gas and cck were identified from genomic and transcriptomic databases of spotted sea bass. The PCR products of these genes in the stomach were confirmed by sequencing.

    As shown in Fig. 6, the expression of mln, gas and cck exhibited pronounced increases after incubation with Ghrl at a concentration of 10–6 mol/L for 3 h. However, the expression of mln and cck did not show significant differences after incubation with Ghrl at concentrations of 10–7 or 10–8 mol/L for 3 h. These results indicated that mln, gas and cck expression exhibited sensitivity to Ghrl in a dose-independent manner. The effects of Ghrl peptide treatment on mln, gas and cck mRNA expression were all disappeared after 6 and 12 h of incubation.

    Figure 6.  Effect of Ghrl peptide treatment on mln (a), gas (b) and cck (c) mRNA expression in the spotted sea bass stomach. The results are presented as the means ± SEMs and expressed as fold changes relative to the mRNA expression in the control group incubated without Ghrl peptide. Significant differences for each concentration are denoted by different letters (P < 0.05)

Discussion
  • In the present study, we identified ghrl and its receptors, determined their expression patterns and regulation in the stomach, identified the localization of ghrl mRNA by ISH and investigated the effects of the in vitro administration of Ghrl on mln, gas and cck gene expression. Our findings provide evidence supporting the notion that the Ghrl/Ghs-r system acts as regulator of mln, gas and cck in spotted sea bass.

    We analyzed the sequences and structures of Ghrl and its receptors. The C-terminal portion but not the N-terminal end of the mature Ghrl peptide showed variability. The lack of variation at the N-terminal end can be attributed to the fact that this is the biologically active segment of Ghrl. The first seven amino acids at the N-terminal end of mature Ghrl were found to be highly conserved and include a serine residue at the third position, which is the site of fatty acylation and constitutes an essential modification for the binding of Ghrl to its receptor (Muccioli et al. 2001). In this study, the N-terminal amino acid sequence of sea bass Ghrl (GSSFLSP) showed 100% identity to the corresponding sequences in human, mouse, chicken, European sea bass, bicolor damselfish, and large yellow croaker, but less identity to zebrafish Ghrl (GTSFLSP) (Amole and Unniappan 2009). The high conservation of the biologically active fragment during evolution not only indicates that this peptide is important for organisms but also that its biological function might be well conserved.

    The Ghrl receptors in teleosts, which include Ghs-r1a, Ghs-r1b and Ghs-r1a-like, are more complex and diverse than those in mammals. In this study, we identified two receptors in spotted sea bass and, to ensure consistent terminology with the orthologous genes of other teleosts, we validated the annotation of ghs-r1a and ghs-r1a-like in sea bass through a syntenic analysis with the large yellow croaker genome. These two receptor isoforms are considered to have been derived by a WGD event in teleosts, but a loss of duplication has been observed in some branches. Previous studies have shown that only a small number of fish classified as Percomorpha within the superorder Acanthopterygii have ghs-r1a-like. These include Perciformes species such as spiny bream (Acanthochromis polyacanthus), damselfish (Stegastes partitus) and large yellow croaker (Larimichthys crocea), and Salmoniformes species such as rainbow trout (Oncorhynchus mykiss), Arctic char (Salvelinus alpinus), coho salmon (Oncorhynchus kisutch), and Atlantic salmon (Salmo salar) (Kaiya et al. 2014).

    The ghrl mRNA is mainly expressed in the stomach which is consistent with previous studies of other fish species such as rainbow trout (Kaiya et al. 2003a, b), channel catfish (Kaiya et al. 2005) and Atlantic cod (Xu and Volkoff 2009) and indicates that the main source of ghrl is the stomach. In addition, intensely positive signals of ghrl mRNA were observed in the MUC and SUB of the stomach, whereas no signal was found in the MUSC or SER. These findings are consistent with those for rainbow trout, where ghrl mRNA expression has been observed in both open- and closed-type cells throughout the stomach MUC (Sakata et al. 2004). The ghrl mRNA has also been detected in pituitary gland and muscle. Furthermore, Ghrl can potentially stimulate growth hormone release from primary pituitary cells and an increase in body weight (Xu and Volkoff 2009), protect skeletal muscle from atrophy (Porporato et al. 2013; Sheriff et al. 2012) and promote myoblast differentiation (Filigheddu et al. 2007). The gene expression profiles of the two ghs-r forms showed that both were widely distributed in the liver where particularly high expression levels of ghs-r1a-like were detected. These findings indicate that both forms likely contribute to the functions of ghrl in lipogenesis and glucogenesis (Barazzoni et al. 2005). Ghs-r1a is also distributed in the pituitary gland, which is consistent with the significant increases in plasma growth hormone and pituitary gh mRNA expression observed in channel catfish after the administration of ghrl (Kaiya et al. 2005). Similar observations have been reported for seabream (Chan and Cheng 2004), chickens (Tanaka et al. 2003) and rats (Katayama et al. 2000).

    In this study, the stomach, a digestive glandular organ, was selected to determine the gene expression patterns of ghrl and its receptors in spotted sea bass after different fasting times. The expression level of ghrl under starvation varies widely and is affected by the germline, genetic background, and fasting duration (Beck et al. 2003; Wren et al. 2000). Accordingly, fasting has been reported to upregulate, downregulate or have no effect on ghrl mRNA levels in the gastrointestinal tracts of different fish species (Jönsson et al. 2007; Murashita et al. 2009; Unniappan et al. 2004; Volkoff 2015; Xu and Volkoff 2009). After fasting for 7 days, no significant changes from baseline in the expression of ghrl were observed in the stomach of Nile tilapia (Parhar et al. 2003), whereas ghrl expression in the intestines of grass carp peak after 7 days of fasting (Feng et al. 2013). In Atlantic salmon, the ghrl expression levels were significantly higher after 2 rather than 14 days of fasting (Hevrøy et al. 2011). Taken together, these observations support the hypothesis that in many fish species, increases in Ghrl levels occur mainly at the early stage of fasting and are not always associated with changes in ghrl mRNA expression in the gastrointestinal tract. In this study, the expression levels of ghrl and its receptors declined gradually after the onset of fasting with the lowest expression levels observed at 6 h. This result suggested that lipid and glucose metabolites are mainly consumed within 6 h after fasting, which results in a decrease in the binding of ghrl with its receptors. The highest expression levels of ghrl and ghs-r1a-like were detected after starvation for 12 h, but the expression of ghs-r1a was consistent with that of the control group. These results suggest that in spotted sea bass, Ghrl mainly interacts with the receptor Ghs-r1a-like and acts as a signal of feeding initiation after fasting for 12 h to promote food intake. Moreover, fasting for 24 h decreased the expression level of ghrl but gradually increased that of its receptors. The spatial differences in the expression of the two ghrl receptors suggested functional divergence because duplicated genes might attain new functions through neofunctionalization and subfunctionalization after WGD. In our study, the functional differentiation of the two paralogs might have been caused by changes in sequence and structure. Ghs-r1a-like shows significant differences in its amino acid sequence and structure from Ghs-r1a and exhibits a unique structural feature; specifically, the second extracellular loop (ECL2) located between TMD IV and V is much longer in Ghs-r1a-like than in Ghs-r1a (Kaiya et al. 2013). The specific functional difference between the two paralogs of spotted sea bass ghrl receptors remains to be investigated. To further study the functions of Ghrl in the gastrointestinal tract, we tested the effects of Ghrl on the expression of gastrointestinal-related genes (mln, gas and cck) in gastric fragments through in vitro incubation experiments. The results showed that incubation for 3 h with Ghrl, particularly at a concentration of 10–6 mol/L, increased the expression of mln and gas, but no significant differences from the control expression levels were observed at 6 or 12 h. As a hormone, Ghrl, is thought to stimulate gastrointestinal motility in a manner similar to that observed with gastrointestinal peptides, such as Mln and Gas (Inui et al. 2004). Ghrl and Mln share a number of common features; specifically, these proteins are structurally similar, both are synthesized in the upper gastrointestinal tract and both exert prokinetic effects on gastrointestinal motility (Ohno et al. 2010). In rats, the intravenous administration of Ghrl reportedly stimulates gastric acid secretion and gastric movement by activating the vagal nerve (de la Cour et al. 2004), and gastrin and insulin secretion (Lee et al. 2002). As a result, expression levels of gas and mln were increased in response to Ghrl. In contrast, Ghrl and Cck are gastrointestinal hormones that regulate feeding and are transmitted through activation of the vagal afferent nerve: Ghrl triggers starvation signals, whereas Cck induces satiety signals (Date et al. 2005). Cck has been found to significantly and directly stimulate Ghrl release from the peptic cells of gastric fundic glands (Rehfeld 2006; Shrestha et al. 2009). In this study, Ghrl incubation for 3 h stimulated the expression of cck, which is consistent with the previous finding that a single bolus injection of cck in rats significantly increase ghrl release by approximately fourfold (Murakami et al. 2002).

    In conclusion, we identified and characterized the Ghrl/Ghs-r system in spotted sea bass and analyzed its roles in stimulating food intake in this species. Using ISH, we found that ghrl was highly expressed in the stomach and localized in the MUC and SUB. Both the ghs-r1a and ghs-r1a-like genes were highly expressed in the liver. Short-term starvation for 6 h decreased the expression levels of ghrl and its receptors. After fasting for 12 h, the results showed that Ghrl mainly interacted with Ghs-r1a-like as a signal of feeding initiation to promote food intake. In addition, the Ghrl peptide stimulated the expression of mln, gas and cck, with expressions levels reaching a maximum after 3 h in vitro incubation. In summary, this study provides new evidence regarding the functions of the Ghrl/Ghs-r system in regulating food intake in spotted sea bass.

Materials and methods

    Animal preparation and short-term starvation

  • Spotted sea bass (weighing 100.0 ± 5.0 g) were obtained from the Shuangying aquatic breeding factory in Lijin, Shandong. Before the experiment, 100 healthy spotted sea bass were acclimatized in an indoor pool for 2 weeks. The temperature is maintained at 19–21 ℃. The fish were fed twice per day until satiety at 9:00 a.m. and 5:00 p.m., and 1/3 of the water was exchanged every day. Fish sampling was conducted after 0, 1, 6, 12, 24, 48 and 72 h of short-term starvation following a meal, and 0 h was used as the control time point. We sampled three fish randomly after each of the different fasting durations. Each fish was anesthetized with MS-222 (200 mg/L).

  • Cloning and sequence analysis of ghrl and its receptors

  • The ghrl and its receptors were identified by searching the whole genome sequence database (PRJNA408177) and the transcriptomic database (PRJNA407434) using TBLASTN (1e-5) (Zhang et al. 2017). The available amino acid sequences of ghrl and its receptors in humans and zebrafish retrieved from NCBI (https://www.ncbi.nlm.nih.gov/) were used as queries. The amino acid sequences were predicted using the online tool ORF finder (https://www.ncbi.nlm.nih.gov/orffinder/) and further verified by Smart-BLAST against the NCBI nonredundant (NR) protein sequence database. SignalP 4.1 Server (https://www.cbs.dtu.dk/services/SignalP/) and NeuroPred (http://stagbeetle.animal.uiuc.edu/cgi-bin/neuropred.py) were used to predict the signal peptide and the neuropeptide prohormone cleavage sites, respectively. Potential transmembrane helices in the encoded amino acid sequences were predicted using TMHMM Server v2.0 (https://www.cbs.dtu.dk/services/TMHMM/). To obtain additional information for gene identification and orthology, a syntenic analysis was conducted by comparing the syntenic regions that harbor genes in spotted sea bass with those in other species based on genome information from the Ensembl genome and NCBI databases. The sequences of Ghrl and its receptors in spotted sea bass and several representative vertebrates were used for the phylogenetic analysis. Multiple protein sequence alignments were constructed using DNAMAN 6.0 with the default parameters. The phylogenetic tree was built with MEGA 6 (Tamura et al. 2013).

  • Quantitative real-time PCR

  • The gonads, intestine, liver, brain, spleen, skin, gill, kidney, pronephros, stomach, heart, pituitary gland, muscle and fin were collected and stored at - 80 ℃. Total RNA from the samples was extracted using RNAiso Plus reagent (Takara, Otsu, Japan) according to the manufacturer's instructions. The concentration and integrity of the extracted RNAs were examined using the Biodropsis BD-1000 nucleic acid analyzer (OSTC, Beijing) and electrophoresis. Complementary DNA was synthesized using the PrimeScript™ RT Reagent Kit (Takara, Otsu, Japan) with gDNA Eraser (Perfect Real Time) (RR047A Takara) following the manufacturer's instructions. All cDNA products were diluted to 250 ng/μl for quantitative real-time PCR.

    The StepOnePlus Real-Time PCR system (Applied Biosystems, USA) was used to detect the mRNA expression of ghrl and its receptors in various tissues of spotted sea bass including stomach tissue at each fasting time point. In addition, we analyzed the mRNA expression of gastrointestinal feeding-related genes (mln, gas, and cck) after static incubation for different times (3, 6, and 12 h) and with different concentrations (10–6, 10–7, and 10–8 mol/L). The specific primers used for quantitative real-time RT-PCR are listed in Table 1. Based on our previous gene expression study of spotted sea bass, 18S ribosomal RNA (18S) was used as the internal positive control for qRT-PCR normalization (Wang et al. 2018). Triplicate RNA samples were used for gene expression profile analysis. Each 20-μl qRT-PCR contained 10 μl of SYBR FAST qPCR Master Mix (2X), 0.4 μl of ROX, 2 μl of template cDNA, 0.4 μl of each primer and 6.8 μl of nuclease-free water. The entire PCR process consisted of 95 ℃ for 2 min, 40 cycles of 95 ℃ for 15 s and 56 ℃ for 15 s and a final extension at 72 ℃ for 2 min. For the gene qPCR assay, the melting curve analysis showed a single peak, which confirmed the specificity of the PCRs. To analyze the expression of the genes in spotted sea bass tissues, the Ct values of each gene in various tissues were measured and 18S rRNA was used as the reference for the normalization of the relative expression of the genes. The comparative 2-ΔΔCT method was used to analyze the relative mRNA expression levels.

    Primer name Primer sequence 5′–3′
    ghrl-F ACACCTGTTTGCTGGTCTTTC
    ghrl-R ATGTGATGTGGTTGGCCTCTG
    ghs-r1a-F CTACTTGGCGATCTGCTTCC
    ghs-r1a-R CACTGCGTAATGCGTCATCT
    ghs-r1a-like-F TTTTGGATGCTGAGATGGGA
    ghs-r1a-like-R ACTGGATAAGGTGCGGAGGT
    mln-F TGCTGATGAAGGAGCGAGAA
    mln-R TCCACCATGTTCCACCTGAG
    gas-F TGCTAAGAGGGAGAAACTG
    gas-R TATCTCGCGTTCATCGTC
    cck-F TGCCAACTACAACCAACCT
    cck-R GCGTCGTCCAAAGTCCAT
    18S-F GGGTCCGAAGCGTTTACT
    18S-R TCACCTCTAGCGGCACAA

    Table 1.  Primers used for quantitative RT-PCR of hormone genes and their receptors

  • ISH of ghrl and its receptors in spotted sea bass

  • Sea bass stomach samples were fixed overnight at room temperature in buffered 4% paraformaldehyde, dehydrated, embedded in paraffin, and cut in sections of 7 μm thickness. The primers used for probe preparation are listed in Table 2. Specific nonisotopic antisense and sense riboprobes were synthesized using the DIG RNA Labeling Kit (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's instructions. DIG-labeled ISH was performed as described previously (Zhou et al. 2019), and the sections were examined by light microscopy.

    Primer name Primer sequence 5′–3′
    ghrl probe-F CGCATTTAGGTGACACTATAGAAGCGACCTGTTTGCTGGTCTTT
    ghrl probe-R CCGTAATACGACTCACTATAGGGAGACATCAAAGTTGTGATGGTCTC

    Table 2.  Probe primers for in situ hybridization

  • In vitro actions of spotted sea bass Ghrl on the expression of mtn, gas and cck mRNAs in stomach fragments

  • Spotted sea bass Ghrl was synthesized by GL Biochem, Shanghai, China. The peptide was purified by HPLC to > 97%, dissolved to the required concentration in DMSO (cell-culture grade), and diluted in culture media for in vitro experiments.

    The fish were anesthetized with MS-222 (200 mg/L) before sampling. The gastric tissue was washed three times with phosphate-buffered saline (PBS), cut into small pieces (1 mm3) and placed in a 24-well plate containing 1 ml of culture medium 199 (M199), which contained 100 U/ml penicillin, 100 mg/ml streptomycin and 20% FBS. After preincubation at 28 ℃ for 6 h, the medium was replaced with fresh culture medium containing Ghrl (10–6, 10–7, or 10–8 mol/L). After incubation for 3, 6 and 12 h, gastric fragments were collected and stored at - 80 ℃ for subsequent RNA extraction and real-time PCR.

  • Statistical analysis

  • The values are presented as the means ± SEMs (n = 3). The data were analyzed by one-way ANOVA and Duncan's method for multiple comparisons using SPSS 17.0 software. Differences were considered significant at P < 0.05.

Acknowledgements
  • This work was supported by the National Key R & D Program of China (Grant number 2018YFD0900101); the China Agriculture Research System (CARS-47); and the Key Laboratory of Mariculture (KLM), Ministry of Education, Ocean University of China (2018008). The authors thank Yanbo Hu and Haolong Wang for assistance with the experimental procedures and sample collection.

Author contributions
  • HW and YL designed this research study. PY wrote the article. Yangyang Zhou et al. helped with the experiments. All the authors read and approved the final manuscript.

Compliance with ethical standards
  • Conflict of interest The authors declare no conflicts of interest.

    Animal and human rights statement: All animal experiments were conducted in accordance with established guidelines and approved by the respective Animal Research and Ethics Committees of Ocean University of China (Permit Number: 20141201).

Reference (55)

Catalog

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return