Optimal amounts of coconut oil in diets improve the growth, antioxidant capacity and lipid metabolism of large yellow croaker (<i>Larimichthys crocea</i>)

Tao Ding; Ning Xu; Yongtao Liu; Xueshan Li; Xiaojun Xiang; Dan Xu; Chuanwei Yao; Qiangde Liu; Zhaoyang Yin; Kangsen Mai; Qinghui Ai

doi:10.1007/s42995-020-00045-z

Volume 2 Issue 4

Nov. 2020

Turn off MathJax

Article Contents

Abstract

References

Marine Life Science & Technology > 2020 > 2(4): 376-385. > DOI: 10.1007/s42995-020-00045-z

Tao Ding, Ning Xu, Yongtao Liu, Xueshan Li, Xiaojun Xiang, Dan Xu, Chuanwei Yao, Qiangde Liu, Zhaoyang Yin, Kangsen Mai, Qinghui Ai. 2020: Optimal amounts of coconut oil in diets improve the growth, antioxidant capacity and lipid metabolism of large yellow croaker (Larimichthys crocea). Marine Life Science & Technology, 2(4): 376-385. DOI: 10.1007/s42995-020-00045-z

Citation:

PDF (1146 KB)

Optimal amounts of coconut oil in diets improve the growth, antioxidant capacity and lipid metabolism of large yellow croaker (Larimichthys crocea)

1.
Key Laboratory of Aquaculture Nutrition and Feed, Ministry of Agriculture and Rural Affairs, and Key Laboratory of Mariculture, Ministry of Education, Ocean University of China, Qingdao 266003, China
2.
Laboratory for Marine Fisheries Science and Food Production Processes, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266237, China

Corresponding author:
Qinghui Ai qhai@ouc.edu.cn
Received Date: 2020-03-06
Accepted Date: 2020-04-27
Published online: 2020-05-28

Graphical Abstract

Abstract

Abstract

The purpose of this study was to investigate the effect of different dietary coconut oil (CO) levels on growth, antioxidant capacity and lipid metabolism of juvenile large yellow croaker (Larimichthys crocea). Five iso-nitrogen (45% crude protein) and iso-lipid (13% crude lipid) experimental diets were prepared by replacing 0% (the control), 25%, 50%, 75% and 100% fish oil with coconut oil. The results showed that dietary CO had no significant effect on survival rate (SR, P > 0.05). However, the specific growth rate was increased significantly when compared with the control group when fish were fed the diet with 50% CO (P < 0.05). The saturated fatty acids were increased significantly with increasing dietary CO in the liver and muscle, whereas the content of n-3 PUFA was decreased significantly (P < 0.05). The highest activities of glutathione peroxidase and superoxide dismutase in the liver were recorded in fish-fed diet with 50% CO; conversely, the content of malondialdehyde was significantly decreased (P < 0.05). The mRNA expression of peroxisome proliferator-activated receptor α, carnitine palmitoyl transferase 1 and acyl-CoA oxidase reached the highest levels in fish-fed diet with 50% CO. To some extent, this indicated that the rapid oxidation reaction of fatty acids to provide energy may be the reason for the rapid growth of large yellow croaker. In conclusion, fish-fed diet with 50% CO increased the growth rate and antioxidant capacity. Therefore, the optimal replacement level of CO to FO in the diet should be 50%.
- Coconut oil,
- Growth performance,
- Antioxidant capacity,
- Lipid metabolism,
- Larimichthys crocea

FullText(HTML)

Introduction

With the continuous expansion of aquaculture and the decline of fish oil (FO) production, the search for suitable FO substitutes has become the focus of attention (FAO 2012; Tacon and Metian 2008). Coconut oil (CO) is regarded as cheaper, more sustainable, and is readily available than the FO. Unlike most oils, CO enriches with middle chain fatty acids (MCFAs), with lauric acid (C12:0) representing 40-50% of the total fatty acids (Figueiredo et al. 2011; Fontagne et al. 2000). For this reason, CO is the most stable oil and its resistance to oxidative rancidity means that it will not be damaged by warmer temperatures (Alice et al. 2006). CO is still an emerging oil with more beneficial effects, and it has a tremendous potential with its cost, sustainability and availability. This makes it a good choice for FO replacement as compared to other vegetable oils (VO) (Apraku et al. 2017; Nordrum et al. 2003; Tseng and Lin 2020).

Many experiments have been conducted to study the effect of CO in diets. In mammals, it has been proven that coconut oil (CO) may be better absorbed and utilized in infant pigs and sheep as compared to other lipids (James et al. 2002; Li et al. 1990; Machmüller et al. 2003). Also, studies in fish have shown that dietary FO partially replaced by CO may significantly increase the growth performance of orange-spotted grouper (Tseng and Lin 2020) and African catfish (Aderolu and Akinremi 2009). Furthermore, some studies with carp (Fontagne et al. 2000), rainbow trout (Ballestrazzi et al. 2006) and Atlantic salmon (Røsjø et al. 2000) found that dietary CO is well absorbed without significant adverse effects on the growth performance. However, Craig and Gatlin (1997) reported that red drum fed diets with a high proportion of CO showed significantly reduced growth rate and increased liver lipid deposition. Similar conclusions were reached with Russian sturgeon; the growth was decreased when fed high CO diets (Li et al. 2017). This may be due to the different species of fish and the proportion of dietary CO in diets. There have been some studies concerning the application of coconut oil in diets for aquatic animals. However, the role of CO in whole or in part replacing FO in promoting growth, antioxidant capacity and lipid metabolism capacity needs further study. Therefore, it is important to explore the appropriate level of CO to replace FO in diets (Tables 1, 2).

Table 1. Formulation and proximate analysis of the experimental diet for large yellow croaker (% dry matter)

Ingredients	Coconut oil replacement level (%)
Ingredients	0%	25%	50%	75%	100%
Fish meal	33.00	33.00	33.00	33.00	33.00
Soybean meal	24.00	24.00	24.00	24.00	24.00
Wheat starch	23.75	23.75	23.75	23.75	23.75
Wheat gluten meal	5.00	5.00	5.00	5.00	5.00
Fish oil	8.00	6.00	4.00	2.00	0.00
Coconut oil	0.00	2.00	4.00	6.00	8.00
Lecithin	2.00	2.00	2.00	2.00	2.00
Vitamin premix	2.00	2.00	2.00	2.00	2.00
Mineral premix	1.00	1.00	1.00	1.00	1.00
Mold inhibitor	0.10	0.10	0.10	0.10	0.10
Ethoxyquin	0.05	0.05	0.05	0.05	0.05
Choline chloride	0.10	0.10	0.10	0.10	0.10
Attractant	1.00	1.00	1.00	1.00	1.00
Total	100	100	100	100	100
Ingredient
Crude protein (%DM)	45.37	45.56	45.37	45.51	45.41
Crude lipid (%DM)	13.40	13.35	13.36	13.41	13.24
All those ingredients were supplied by Great Seven Biotechnology Co., Ltd, China Vitamin premix (mg/kg or g/kg diet): thiamine, 25 mg; riboflavin, 45 mg; pyridoxine HCl, 20 mg; vit. B12, 0.1 mg; vit. K3, 10 mg; inositol, 800 mg; pantothenic acid, 60 mg; niacin acid, 200 mg; folic acid, 20 mg; biotin, 1.20 mg; retinol acetate, 32 mg; cholecalciferol, 5 mg-α-tocopherol, 120 mg; ascorbic acid, 2000 mg; choline chloride, 2500 mg; ethoxyquin, 150 mg; wheat middling, 14.01 g Mineral premix (mg/kg or g/kg diet): NaF, 2 mg; KI, 0.8 mg; CoCl₂·6H₂O (1%), 50 mg; CuSO₄·5H₂O, 10 mg; FeSO₄·H₂O, 80 mg; ZnSO₄·H₂O, 50 mg; MnSO₄·H₂O, 60 mg; MgSO₄·7H₂O, 1200 mg; Ca (H₂PO₄)2·H₂O, 3000 mg; NaCl, 100 mg; Zeolite, 15.447 g Mold inhibitor: sodium propionate Attractant: the mixture of 50% glycine acid and 50% betaine by weight

| Show Table

DownLoad: CSV

Table 2. Fatty acid profiles of the experimental diets (% total fatty acids)

Ingredients	Coconut oil replacement level (%)
Ingredients	0%	25%	50%	75%	100%
C8:0	0.00	1.15	2.15	3.29	4.27
C10:0	0.00	1.01	1.89	2.85	3.81
C12:0	0.43	7.52	14.01	21.37	28.11
C14:0	5.75	7.31	8.56	9.67	11.04
C16:0	19.28	17.18	15.73	13.52	12.10
C18:0	4.19	3.81	3.64	3.48	3.27
∑SFA^a	29.64	35.83	41.95	48.04	54.52
C16:1n-7	4.02	3.32	2.52	1.79	1.03
C18:1n-9	12.32	11.02	9.69	8.51	7.20
∑MUFA^b	16.34	14.34	12.20	10.30	8.22
C18:2n-6	10.36	10.75	11.22	11.60	11.96
C20:4n-6	0.61	0.52	0.41	0.34	0.22
∑n-6 PUFA^c	10.97	11.26	11.63	11.93	12.18
C18:3n-3	1.84	1.70	1.59	1.48	1.37
C20:5n-3	5.68	4.90	4.22	3.48	2.68
C22:6n-3	8.19	7.17	6.13	5.15	3.99
∑n-3 PUFA^d	15.71	13.78	11.94	10.12	8.03
^aSFA: saturated fatty acids ^bMUFA: mono-unsaturated fatty acids ^cn-6 PUFA: n-6 poly-unsaturated fatty acids ^dn-3 PUFA: n-3 poly-unsaturated fatty acids

| Show Table

DownLoad: CSV

Large yellow croaker (Larimichthys crocea) is one of the most productive mariculture fish in China. Studies on the substitution of VO for FO in the diet of large yellow croaker involve mainly consideration of soybean oil, palm oil and rapeseed oil. The possibility of substituting CO for FO in diets has not been reported (Du et al. 2017; Li et al. 2019a, b; Tan et al. 2016). Consequently, the purpose of this study was to investigate the effect of different dietary coconut oil (CO) levels on growth, antioxidant capacity and lipid metabolism of juvenile large yellow croaker. Moreover, the work aimed to provide the theoretical basis for the application of CO in feed.

Results

Survival and growth performance

There was no significant difference in survival rate (SR) among dietary treatments (P > 0.05). With increasing dietary CO, the specific growth rate (SGR) increased first and then decreased. In fish that were fed the diet with 50% CO, the SGR was significantly higher than the control group (P < 0.05). The hepatosomatic index (HSI) was increased by increasing dietary CO. Thus, fish-fed diets containing 75% and 100% CO had significantly higher HSI than the control group (P < 0.05) (Table 3).

Table 3. Survival and growth performance of large yellow croaker-fed diets with graded levels of coconut oil

Index	Coconut oil replacement level (%)
Index	0%	25%	50%	75%	100%
Survival rate (%)	81.67 ± 2.11	83.33 ± 3.41	82.78 ± 3.09	84.44 ± 4.03	86.11 ± 2.88
Initial body weight (g)	11.92 ± 0.23	12.04 ± 0.29	11.99 ± 0.14	12.02 ± 0.05	12.01 ± 0.20
Final body weight (g)	59.28 ± 2.11^a	63.12 ± 1.98^a	70.75 ± 3.44^b	65.5 ± 0.89^ab	61.12 ± 1.66^a
Specific growth rate (%/day)	2.32 ± 0.12^a	2.37 ± 0.11^a	2.54 ± 0.17^b	2.42 ± 0.09^ab	2.35 ± 0.06^a
Hepato-somatic index (%)	1.25 ± 0.12^a	1.21 ± 0.10^a	1.2 ± 0.09^a	1.41 ± 0.13^b	1.55 ± 0.14^c
The data are expressed as means SEM. The data with the same superscript show no significant difference (P > 0.05). SEM, standard error of means (n = 3)

| Show Table

DownLoad: CSV

Body composition

No significant differences were observed among dietary treatments in terms of the moisture, ash, crude protein, crude lipid and muscle lipid (P > 0.05). When compared with the control group, the liver lipid was significantly increased in fish-fed diets with 75% and 100% CO (P < 0.05). Moreover, in fish-fed diet with 100% CO, the liver lipid was the highest. This was significantly higher than the other groups (P < 0.05) (Table 4).

Table 4. Body composition (dry weight %) of large yellow croaker-fed diets with graded levels of coconut oil

Index	Coconut oil replacement level (%)
Index	0%	25%	50%	75%	100%
Moisture (%)	73.25 ± 1.66	73.31 ± 0.99	73.82 ± 2.01	73.76 ± 2.33	73.45 ± 1.33
Ash (% d.w.)	13.02 ± 0.33	13.18 ± 0.28	13.2 ± 0.19	13.08 ± 0.23	13.19 ± 0.26
Crude protein (% d.w.)	60.59 ± 0.64	59.86 ± 0.55	61.49 ± 0.19	61.84 ± 0.77	60.36 ± 1.12
Crude lipid (% d.w.)	30.34 ± 0.33	30.39 ± 0.31	28.58 ± 0.55	28.44 ± 0.62	29.30 ± 0.58
Liver lipid content (% d.w.)	59.60 ± 1.30^a	58.22 ± 1.51^a	61.25 ± 1.28^ab	64.77 ± 1.52^b	69.85 ± 0.57^c
Muscle lipid content (% d.w.)	24.38 ± 0.61	24.91 ± 0.97	24.7 ± 0.53	23.77 ± 0.53	23.69 ± 0.44
The data are expressed as means SEM. The data with the same superscript show no significant difference (P > 0.05). SEM standard error of means (n = 3) d.w. dry weight

| Show Table

DownLoad: CSV

The liver and muscle fatty acid composition

The liver saturated fatty acids (SFAs) (C10:0, C12:0, C14:0 and C18:0) were significantly increased in fish-fed diets with increasing dietary CO when compared with the control group (P < 0.05). However, the content of C16:0 and monounsaturated fatty acids (MUFA) (C16:1n-7 and C18:1n-9) in fish-fed diets with CO were not significantly different among the dietary treatments (P > 0.05). The liver content of C20:4n-6 showed a decreasing trend with increasing dietary CO, but there was not any significant difference among dietary treatments (P > 0.05). The liver content of C18:3n-3, C20:5n-3 and C22:6n-3 was significantly decreased with increasing dietary CO, and the ratio of n-3 PUFA/n-6 PUFA was also significantly decreased (P < 0.05).

Similarly to liver, the muscle SFAs (C10:0, C12:0, C14:0 and C18:0) were significantly increased with increasing dietary CO (P < 0.05). However, the muscle content of C16:1n-7 was gradually decreased with increasing dietary CO. When the dietary CO was higher than 50%, the muscle content was significantly higher than the control group (P < 0.05). Meanwhile, the trend of MUFA and C20:4n-6 was the same as the C16:1n-7. However, the n-6 PUFA was not significantly different among dietary treatments in the muscle (P > 0.05). When dietary CO was higher than 50%, the muscle n-3 PUFA (C18:3n-3, C20:5n-3 and C22:6n-3) were decreased significantly than the control group (P < 0.05). Also, the ratio of n-3 PUFA / n-6 PUFA was decreased significantly with increasing dietary CO (P < 0.05) (Tables 5, 6).

Table 5. Fatty acid composition (% total fatty acids) in the liver of large yellow croaker-fed diets with graded levels of coconut oil

Index	Coconut oil replacement level (%)
Index	0%	25%	50%	75%	100%
C8	0	0	0	0	0
C10	0	0.03 ± 0.01^a	0.10 ± 0.01^b	0.20 ± 0.02^b	0.27 ± 0.02^c
C12	0.28 ± 0.03^a	1.54 ± 0.12^b	3.19 ± 0.15^c	5.74 ± 0.55^d	7.13 ± 0.65^d
C14	3.30 ± 0.08^a	4.23 ± 0.31^a	5.82 ± 0.12^b	8.48 ± 0.45^c	9.90 ± 0.22^d
C16	19.37 ± 1.56	21.46 ± 0.56	21.97 ± 0.61	21.17 ± 0.91	21.82 ± 0.89
C18	5.63 ± 0.28^a	7.73 ± 0.21^b	7.83 ± 0.31^b	8.49 ± 0.39^b	10.12 ± 0.22^c
∑SFA	28.58 ± 1.59^a	34.98 ± 1.09^ab	38.92 ± 0.98^bc	44.08 ± 2.33^cd	49.24 ± 1.43^d
C16:1n-7	7.21 ± 0.42	6.77 ± 0.32	6.80 ± 0.47	6.03 ± 0.18	6.39 ± 0.11
C18:1n-9	16.85 ± 1.15	17.87 ± 1.18	16.69 ± 0.42	17.92 ± 0.77	17.31 ± 0.71
∑MUFA	24.06 ± 1.58	24.65 ± 1.49	23.50 ± 0.99	23.95 ± 0.86	23.70 ± 0.83
C18:2n-6	11.75 ± 0.63	11.65 ± 0.61	11.21 ± 1.13	11.90 ± 0.25	10.29 ± 0.26
C20:4n-6	0.71 ± 0.02^cd	0.66 ± 0.05^c	0.59 ± 0.01^bc	0.51 ± 0.02^b	0.34 ± 0.03^a
∑n-6 PUFA	12.46 ± 0.62	12.31 ± 0.15	11.80 ± 1.23	12.41 ± 0.25	10.62 ± 0.27
C18:3n-3	1.94 ± 0.07^c	1.67 ± 0.02^b	1.55 ± 0.02^b	1.54 ± 0.03^b	1.12 ± 0.01^a
C20:5n-3	3.89 ± 0.14^e	3.38 ± 0.03^d	2.69 ± 0.05^c	2.31 ± 0.03^b	1.22 ± 0.02^a
C22:6n-3	5.60 ± 0.32^d	4.55 ± 0.10^c	3.17 ± 0.10^b	2.36 ± 0.07^b	1.15 ± 0.08^a
∑n-3 PUFA	11.43 ± 0.35^e	9.60 ± 0.15^d	7.41 ± 0.16^c	6.21 ± 0.07^b	3.48 ± 0.11^a
n-3/n-6 PUFA	0.92 ± 0.06^d	0.78 ± 0.01^cd	0.63 ± 0.05^bc	0.50 ± 0.02^ab	0.33 ± 0.01^a
The data are expressed as means SEM. The data with the same superscript show no significant difference (P > 0.05) SEM standard error of means (n = 3) SFA saturated fatty acids, MUFA mono-unsaturated fatty acids, n-6 PUFA n-6 poly-unsaturated fatty acids, n-3 PUFA n-3 poly-unsaturated fatty acids

| Show Table

DownLoad: CSV

Table 6. Fatty acid composition (% total fatty acids) in the muscle of large yellow croaker-fed diets with graded levels of coconut oil

Index	Coconut oil replacement level (%)
Index	0%	25%	50%	75%	100%
C8	0	0	0	0	0
C10	0	0.15 ± 0.02^a	0.33 ± 0.03^b	0.52 ± 0.07^cd	0.73 ± 0.12^d
C12	0.60 ± 0.01^a	3.50 ± 0.21^b	6.53 ± 0.53^c	9.95 ± 0.76^d	12.43 ± 1.02^d
C14	3.87 ± 0.10^a	5.26 ± 0.11^b	7.01 ± 0.24^c	8.40 ± 0.07^d	9.87 ± 0.52^d
C16	19.94 ± 0.32	19.63 ± 0.18	19.33 ± 0.52	18.98 ± 0.53	18.74 ± 0.14
C18	4.02 ± 0.16^a	4.34 ± 0.24^ab	4.63 ± 0.14^ab	4.98 ± 0.15^bc	5.31 ± 0.17^c
∑SFA	28.24 ± 0.39^a	32.74 ± 0.56^b	37.49 ± 1.18^c	42.31 ± 0.80^d	46.45 ± 1.47^e
C16:1n-7	4.62 ± 0.05^d	4.22 ± 0.02 ^cd	3.77 ± 0.15^bc	3.40 ± 0.14^ab	2.99 ± 0.23^a
C18:1n-9	14.50 ± 0.33	14.24 ± 0.03	13.99 ± 0.48	13.88 ± 0.37	13.66 ± 0.34
∑MUFA	19.12 ± 0.28^c	18.46 ± 0.04^bc	17.77 ± 0.62^ab	17.28 ± 0.50^ab	16.65 ± 0.50^a
C18:2n-6	11.70 ± 0.41	11.41 ± 0.10	11.64 ± 0.26	11.55 ± 0.55	11.67 ± 0.32
C20:4n-6	0.76 ± 0.01^c	0.66 ± 0.01^bc	0.55 ± 0.02^b	0.44 ± 0.04^a	0.34 ± 0.05^a
∑n-6 PUFA	12.46 ± 0.42	12.08 ± 0.09	12.19 ± 0.27	11.78 ± 0.59	12.02 ± 0.35
C18:3n-3	1.57 ± 0.04^b	1.51 ± 0.01^b	1.33 ± 0.04^a	1.25 ± 0.08^a	1.21 ± 0.06^a
C20:5n-3	4.25 ± 0.18^d	3.72 ± 0.27^cd	3.20 ± 0.02^bc	2.72 ± 0.19^ab	2.48 ± 0.26^a
C22:6n-3	8.28 ± 0.28^d	7.37 ± 0.21^cd	6.37 ± 0.20^bc	5.19 ± 0.53^ab	4.63 ± 0.56^a
∑n-3 PUFA	14.10 ± 0.49^d	12.59 ± 0.29^cd	10.90 ± 0.17^bc	9.17 ± 0.79^ab	8.32 ± 0.88^a
n-3/n-6 PUFA	1.31 ± 0.01^c	1.04 ± 0.08^b	0.89 ± 0.02^b	0.76 ± 0.03^a	0.69 ± 0.06^a
The data are expressed as means SEM. The data with the same superscript show no significant difference (P > 0.05). SEM standard error of means (n = 3) SFA saturated fatty acids, MUFA mono-unsaturated fatty acids, n-6 PUFA n-6 poly-unsaturated fatty acids, n-3 PUFA n-3 poly-unsaturated fatty acids

| Show Table

DownLoad: CSV

Oxidation and antioxidant parameters in the liver and intestine

With increasing dietary CO, the activity of glutathione peroxidase (GSH-Px) in the liver increased initially and then decreased. The peak was reached when dietary CO was 50%, which was significantly higher than other groups (P < 0.05). The liver content of malondialdehyde (MDA) was decreased significantly in fish-fed diets with CO; the minimum was in fish receiving food with 50% CO (P < 0.05). Furthermore, dietary CO had no significant effect on the liver enzyme activity of catalase (CAT), superoxide dismutase (SOD) and total antioxidant capacity (T-AOC) (P > 0.05). However, the activities of CAT, GSH-Px and SOD in the intestine were significantly higher in fish-fed diets with CO when compared with the control group (P < 0.05). Dietary CO did not significantly affect the T-AOC and the content of MDA in the intestine (P > 0.05) (Table 7).

Table 7. Antioxidant capacity in the liver and intestine of large yellow croaker-fed diets with graded levels of coconut oil

Index	Coconut oil replacement level (%)
Index	0%	25%	50%	75%	100%
Liver
CAT (U/mgprot)	20.79 ± 0.78	21.55 ± 0.67	20.80 ± 0.37	22.07 ± 0.31	23.04 ± 0.99
GSH-PX (U/mgprot)	113.08 ± 8.06^a	120.38 ± 4.42^ab	166.19 ± 4.36^d	143.67 ± 2.87^c	139.46 ± 1.19^bc
MDA (nmol/mgprot)	18.72 ± 0.27^b	17.77 ± 0.91^ab	15.03 ± 0.28^a	19.37 ± 0.49^b	24.46 ± 0.98^c
SOD (U/mgprot)	140.64 ± 6.72^a	154.62 ± 6.87^ab	163.28 ± 5.92^b	143.10 ± 8.73^a	144.26 ± 4.97^a
T-AOC (U/mgprot)	1.76 ± 0.10	1.74 ± 0.09	1.93 ± 0.11	1.94 ± 0.07	1.86 ± 0.06
Intestine
CAT (U/mgprot)	7.70 ± 0.31^a	11.42 ± 0.83^b	17.15 ± 1.21^c	17.14 ± 0.95^c	18.77 ± 0.91^c
GSH-PX (U/mgprot)	62.08 ± 5.72^a	93.38 ± 3.94^b	128.35 ± 2.91^c	123.00 ± 3.56^c	113.09 ± 2.38^c
MDA (nmol/mgprot)	8.83 ± 1.10	9.01 ± 0.86	8.68 ± 0.66	9.90 ± 1.31	9.99 ± 1.29
SOD (U/mgprot)	96.27 ± 3.69^a	117.11 ± 2.82^b	122.57 ± 3.14^b	136.46 ± 3.43^c	127.71 ± 1.29^bc
T-AOC (U/mgprot)	1.80 ± 0.05	1.98 ± 0.05	1.94 ± 0.06	1.85 ± 0.05	2.01 ± 0.06
The data are expressed as means SEM. The data with the same superscript show no significant difference (P > 0.05). SEM standard error of means (n = 3)

| Show Table

DownLoad: CSV

Expression of genes related to lipid metabolism

Expression of genes associated with lipid synthesis

The mRNA expression of srebp-1 decreased gradually with increasing dietary CO, but there was not any significant difference among dietary treatments (P > 0.05). In fish-fed diets with 75-100% CO, the mRNA expression of acc and scd-1 were decreased significantly compared with other groups (P < 0.05). The mRNA expression of fas was significantly higher in fish-fed diets with 75% and 100% CO than other groups (P < 0.05), especially peaking in the 100% CO group (Fig. 1).

Figure 1. Effects of dietary CO on the relative expression of sterol regulatory element binding protein-1 (srebp-1), stearoyl coenzyme A desaturase (scd-1), and fatty acid synthase (fas), cetyl-CoA carboxylase (acc) in the liver of large yellow croaker. The data are expressed as means SEM. The data with the same superscript show no significant difference (P > 0.05). SEM, standard error of means. (n = 3)

DownLoad: Full-Size Img PowerPoint

Expression of genes associated with lipid β-oxidation

The mRNA expression of cpt-1, aco and ppar-α increased first and then decreased with increasing dietary CO. The peak was reached in the 50% CO group, which was significantly higher than the control group (P < 0.05). The mRNA expression of atgl in fish-fed diets with CO were increased significantly when compared with the control group, peaking in fish-fed diet containing 100% CO (P < 0.05) (Fig. 2).

Figure 2. Effects of dietary CO on the relative expression of peroxisome proliferator-activated receptor α (ppar-α), carnitine palmitoyl transferase 1 (cpt-1), adipose triglyceride lipase (atgl) and acyl-CoA oxidase (aco) in the liver of large yellow croaker. The data are expressed as means SEM. The data with the same superscript show no significant difference (P > 0.05). SEM, standard error of means. (n = 3)

DownLoad: Full-Size Img PowerPoint

Discussion

In the present study, the growth of juvenile large yellow croaker was increased significantly in fish-fed diet containing 50% CO. Tseng and Lin (2020) demonstrated that 30 g/kg CO could increase significantly the growth performance of orange-spotted grouper, which is related to the increase of MCFAs content in diets. When compared with long-chain fatty acids (LCFAs), MCFAs are metabolized more rapidly and completely (Villarino et al. 2007). In addition, MCFAs are easier to be digested and absorbed (Villarino et al. 2007). Furthermore, MCFAs contribute to the absorption and retention of calcium, magnesium and amino acids (Kadota et al. 2015). Therefore, the optimal MCFAs content in diets may be the main reason to promote growth. However, with increasing dietary CO, namely in fish receiving the diet with 100% CO, a sharp decline was observed in the growth performance. This may be caused by the decrease in diets of essential fatty acid (EFA), which carnivorous fish lack the capacity to synthesize de novo by themselves (Kanazawa 1979; Watanabe 1982). The previous studies demonstrated that when dietary FO was totally replaced by VO, the reason for the decline in growth of marine fish was mostly related to the deficiency of EFA (Turchini et al. 2009; Zuo et al. 2012). Therefore, in order to meet their growth, immunity as well as the normal reproduction and survival of offspring, marine fish must obtain EFA from diets. Turchini et al. (2009) demonstrated that if dietary EFA requirements are met, a significant portion (60-75%) of dietary FO are able to be substituted with alternative lipid sources without significantly affecting the growth performance. Therefore, in this study, growth was not inhibited significantly in fish-fed diet with 100% CO when compared with the control group probably because the dietary EFA met the requirement.

Many studies showed that lipid metabolism of fish was influenced significantly with different dietary FAs composition (Caballero et al. 2002; López et al. 2009; Xu et al. 2011). In this study, with increasing dietary CO, the SFA content in the liver and muscle were increased significantly as the SFA content in diets. Besides, with the decrease in DHA and EPA in diets, the content of DHA and EPA in the liver and muscle was decreased significantly. However, the rate of decrease was lower than that in diets, indicating that DHA and EPA tended to accumulate in the body to maintain the normal physiological function of the fish (Torstensen et al. 2004; Trushenski et al. 2010; Zuo et al. 2015). In this study, the HSI and liver lipid content were increased significantly in fish-fed diet with 100% CO compared with the control group. This was consistent with the results in sunshine bass (Nematipour and Gatlin Ⅲ 1993) and polka dot grouper (Smith et al. 2005). Previous studies have found that fish-fed diets with too much SFAs could make the liver n-3/n-6 PUFA imbalance, resulting in abnormal deposition of fish liver lipid, which is due to excessive SFA. This could affect the metabolism of fatty acids (Leaver et al. 2006; Wang et al. 2016). Therefore, the imbalance of dietary n-3/n-6 PUFA and the low content of n-3 PUFA after the replacement of FO with a high proportion of CO may be one of the main reasons for liver lipid deposition (Zuo et al. 2012).

Compared with SFAs, PUFAs are more vulnerable to free radicals, and are more prone to peroxides (Ferreri and Chatgilialoglu 2009; Wood 1999). Lipid peroxidation may lead to impaired cell membrane function and inactivation of endogenous antioxidant enzymes (Peng et al. 2016; Winzer et al. 2000). The activities of CAT, SOD, and GSH-Px play key roles in the balance of oxidation and antioxidation in fish (Mourente et al. 2007; Ozkan et al. 2013). MDA is the final decomposition product of lipid peroxidation induced by free radicals, which is an important index to measure the degree of liver damage (Martínez et al. 2003). In this study, fish-fed diet with 50% CO showed the highest activities of SOD and GSH-Px, and had the lowest content of MDA in the liver. This suggests that SOD and GSH-Px may contribute to the suppression of MDA. Moreover, the activities of CAT, SOD and GSH-Px in the intestine were significantly higher when compared with fish-fed diets with CO. The results were in accordance with the previous studies in black seabream (Jin et al. 2017) and Russian sturgeon (Li et al. 2017), which demonstrated that fish-fed diets with CO could improve the antioxidant capacity.

The composition of fatty acids in the diet has a great influence on lipid metabolism, especially in lipid synthesis and β-oxidation. Fatty acid synthase (fas) plays a key role in lipid synthesis in the liver and is a rate-limiting enzyme for fatty acid synthesis (Smith et al. 2003). In this study, fish-fed diets with high levels of CO showed significantly higher mRNA expression of fas. Previous studies have shown that dietary polyunsaturated fatty acids (PUFAs) have an inhibitory effect on fas (Blake and Clarke 1990; Kralova et al. 2008). When a high proportion of CO replaced FO, the content of PUFAs in the diet decreased significantly while the SFAs increased significantly, thus reducing the inhibitory effect on fas in the liver (Bjermo et al. 2012). Conversely, β-oxidation is an important method of lipid metabolism in fish (Flatmark 1988). ppar-α exerts a key role in energy metabolism, which is mainly expressed in the liver. Some important enzymes of fatty acid β-oxidation, such as aco and cpt-1, were regulated by ppar-α (Kersten 2014; Souza-Mello 2015). In this study, fish-fed diet with 100% CO showed the lowest mRNA expression of ppar-α, aco and cpt-1. A previous study using Nile tilapia demonstrated that low expression of ppar-α could decrease lipid degradation, which was similar to that of mammals (Ning et al. 2016). Hence, it was concluded that the main reasons for the increase in lipid content in the liver may be attributed to the inhibition of ppar-α, aco, cpt-1 and the activation of fas, which accelerates the lipid accumulation process in the liver. Dietary CO at an appropriate level has been claimed to have numerous beneficial health effects. Moreover, the utilization efficiency of MUFA is also very efficient when compared with PUFA (Villarino et al. 2007). Therefore, fish-fed diet with 50% CO could facilitate the conversion of fatty acids into energy, and thus promote growth performance.

Conclusion

In summary, the results of this study showed that dietary 50% CO could promote the growth performance of large yellow croaker. The beneficial effects could be attributed to the optimal dietary FAs composition and the increased activities of antioxidant enzymes in the liver and intestine.

Materials and methods

Experimental diets

Five iso-nitrogen (45% crude protein) and iso-lipid (13% crude lipid) experimental diets were prepared by replacing 0% (the control), 25%, 50%, 75% and 100% fish oil with coconut oil. All ingredients were separately crushed in advance, using 0.18 mm sieves. The less used ingredients were mixed thoroughly one by one, then added to other ingredients one at a time and mixed thoroughly in a mixer. The oil was then added with the optimal amount of distilled water and mixed thoroughly. This was passed through a 0.25 mm sieve and thoroughly mixed. Distilled water (300 g/kg) was added to produce a stiff dough. After transferring to a granulator, distilled water (300 g/kg) was added with stirring in the opposite direction to make a dough. This was extruded into 4 mm particles. All diets were dried in a ventilated oven at 40 ℃ until attaining a moisture level below 5% and stored at - 20 ℃ in opaque bags. Procedures for making diets and their storage was in accordance with specific procedures described by Ai et al. (2008).

Experimental procedures

Before the start of the study, the fish were acclimatized to a floating sea of 4 m × 4 m × 4 m in size for two weeks. Then, 60 fish of similar size (12.00 ± 0.20 g) were randomly distributed among 15 sea cages (1 m × 1 m × 1.5 m in size). Each diet was fed to the fish in three cages. The fish were fed twice daily at 5:00 and 17:00 for 10 weeks. After the end of the study, all the fish were starved for 24 h, and the fish in each cage were anesthetized and weighed. Environmental conditions (temperature 24.3-29.1 ℃, salinity 26.2-28.7‰, oxygen level 6.2-7.4 mg/L) were good for acclimation.

Sample collection and analysis

The fish were sampled 24 h after starvation. Eugenol (1:10, 000) was used for anaesthesia; the weight and number of fish in each cage were weighed and counted, and three fish were randomly taken and stored in - 20 ℃ for experimental analysis. The fish livers were weighed, and the hepatosomatic index (HSI) was calculated. The livers from 12 fish (groups of three were mixed in a single tube) were immediately placed into the labelled cryopreservation tube in liquid nitrogen and stored at - 80 ℃ before analysis.

The sample was in a ventilated 105 ℃ drying oven to dry the sample to constant weight (AOAC 2003). The crude protein (whole body protein), crude lipid (whole body lipid) and the ash of the sample were determined after Ai et al. (2008). The fatty acid composition was analyzed using the procedures described by Metcalfe et al. (1966). Fatty acid methyl esters were identified and quantified by an HP6890 gas chromatograph (Agilent Technologies, Santa Clara, California, USA) with a capillary column (007-CW, Hewlett Packard, Palo Alto, CA, USA) and a flame ionization detector.

Antioxidant and lipid metabolism index

Malondialdehyde (MDA), total antioxidant capacity (T-AOC), superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GSH-Px) and malondialdehyde (MDA) were measured via the test kit produced by Nanjing Jiancheng Bioengineering Institute (China). All procedures were carried out in strict accordance with the instructions.

RNA extraction and real-time quantitative PCR

The samples were ground in liquid nitrogen, and ~ 100 mg samples were taken and fully reacted in 1 ml RNAiso TM Plus from Takara (Japan) for total RNA extraction. RNA concentration and purity were determined by ultraviolet colorimetry (Nanodrop Thermo Fisher Scientific, USA), and RNA quality was determined by 1.5% agarose gel electrophoresis. The total RNA concentration was diluted to 500 ng/µl, and reverse transcription was performed immediately with the kit from Takara (Japan).

The real-time quantitative PCR procedure was performed in a total volume of 20 µl. The technique was programmed as follows. 95 ℃ for 2 min, followed by 40 cycles of 95 ℃ for 10 s, 58 ℃ for 15 s, and 72 ℃ for 10 s. The specificity of the product was determined by melting point curve analysis. The primer sequences (sterol-regulatory element binding protein-1 (srebp-1), fatty acid synthase (fas), stearoyl-coenzyme A desaturase (scd-1), peroxisome proliferator-activated receptor α (ppar- α), cetyl-CoA carboxylase (acc), adipose triglyceride lipase (atgl), acyl-CoA oxidase (aco), carnitine palmitoyltransferase1 (cpt-1) and β-actin) were calculated according to Tan et al. (2016) (Table 8).

Table 8. Primer pair sequences for real-time PCR

Target genes	Forward (5′–3′)	Reverse (5′–3′)	References
srebp-1	TCTCCTTGCAGTCTGAGCCAAC	TCAGCCCTTGGATATGAGCCT	Cai et al. (2016)
scd-1	AAAGGACGCAAGCTGGAACT	CTGGGACGAAGTACGACACC	Cai et al. (2016)
fas	CAGCCACAGTGAGGTCATCC	TGAGGACATTGAGCCAGACAC	Yan et al. (2015)
acc	TGTCGGAGGAGAACTCGGAAG	GCCTTAGATTCTGCACGGGG	Yan et al. (2015)
ppar-α	GTCAAGCAGATCCACGAAGCC	TGGTCTTTCCAGTGAGTATGAGCC	Yan et al. (2015)
cpt-1	GCTGAGCCTGGTGAAGATGTTC	TCCATTTGGTTGAATTGTTTACTGTCC	Yan et al. (2015)
atgl	CCATGCATCCGTCCTTCAACC	GAGATCCCTAACCGCCCACT	Yan et al. (2015)
aco	AGTGCCCAGATGATCTTGAAGC	CTGCCAGAGGTAACCATTTCCT	Yan et al. (2015)
β-actin	CTACGAGGGTTATGCCCTGCC	TGAAGGAGTAACCGCGCTCTGT	Yan et al. (2015)
srebp-1 sterol-regulatory element binding protein-1, scd-1 stearoyl-coenzyme A desaturase, fas fatty acid synthase, acc acetyl-CoA carboxylase, ppar-α peroxisome proliferator-activated receptor α, cpt-1 carnitine palmitoyl transferase 1, atgl adipose triglyceride lipase, aco acyl-CoA oxidase

| Show Table

DownLoad: CSV

Calculations and statistical analysis

Growth and somatic indices were calculated according to the following:

${\text{Weight gain rate}}\, \left({{\text{WGR}}, \% } \right)\, = \, \left({w_{{\text{t}}} \, - \, w_{o} } \right)\, \times \, {\text{1}}00/{\text{w}}_{{\text{o}}} .$

${\text{Specific growth rate}}\, \left({{\text{SGR}}, \% /{\text{day}}} \right)\, = \, \left\{ {\left({{\text{ln}}\left({w_{{\text{t}}} } \right)\, - {\text{ln}}\left({w_{{\text{o}}} } \right)} \right)/{\text{duration }}\left({{\text{7}}0\;{\text{days}}} \right)} \right\}\, \times \, {\text{1}}00.$

${\text{Survival rate}} \, \left({{\text{SR}}, \% } \right)\, = \, {\text{1}}00\, \times \, \left({{\text{FN}}/{\text{IN}}} \right).$

${\text{Hepatosomatic index}}\, \left({{\text{HSI}}, \% } \right)\, = \, {\text{weight of liver}}/{\text{weight of fish}}\, \times \, {\text{1}}00.$

${\text{Feed conversion ratio}}\, \left({{\text{FCR}}} \right)\, = F/\left({w_{{\text{t}}} \, - w_{{\text{o}}} } \right).$

${\text{Protein efficiency ratio}}\, \left({{\text{PER}}} \right)\, = \, \left({w_{{\text{t}}} - w_{{\text{o}}} } \right)/P.$

w_t-final weight of fish, w_o-initial weight of fish, FN-final number, IN-initial number of fish in each cage, F-feed intake (g), P-amount of protein in the diet (%).

A one-way ANOVA was used for data statistics (SPSS 25.0). Tukey's test was used for significance comparison between groups. P < 0.05 indicates a significant difference. The data are expressed as means SEM. The data with the same superscript show no significant difference (P < 0.05).

Acknowledgments

This research was supported by the National Science Fund for Distinguished Young Scholars of China [grant number: 31525024], the China Agriculture Research System [Grant number: CARS47-11], Aoshan Talents Program Supported by Qingdao National Laboratory for Marine Science and Technology [Grant number: 2015ASTP], Key Program of National Natural Science Foundation of China [Grant number: 31830103] and Scientific and Technological Innovation of Blue Granary [Grant number: 2018YFD0900402]. We thank Kun Cui, Jiamin Li and Jinbao Li for their assistance in the study.

Author contributions

QA and TD designed the experiments. TD, NX, YL, QL and ZY participated in breeding experiments and the production of feed. TD, NX, YL, DX, XJ and ZY collected the samples. TD performed the experiments and analyzed the data. TD wrote the paper. QA and KM directed and supervised the experiment. The final manuscript was approved by all the authors.

Compliance with ethical standards

Conflict of interest All the authors declare that there are no conflicts of interest.

Animal and human rights statement All applicable international, national and institutional guidelines for the care and use of animals were followed by the authors.

References (56)

References

Aderolu AZ, Akinremi OA (2009) Dietary effects of coconut oil and peanut oil in improving biochemical characteristics of Clarias gariepinus Juvenile. Turk J Fish Aquat Sc 9:105-110 doi: 10.1577/M07-038.E

Ai QH, Zhao JZ, Mai KS, Xu W, Tan B, Ma H, Liu FZG (2008) Optimal dietary lipid level for large yellow croaker (Pseudosciaena crocea) larvae. Aquac Nutr 14:515-522 doi: 10.1111/j.1365-2095.2007.00557.x

Alice H, Lichtenstein LJ, Appel B, Micheal S, Camethon M (2006) Diet and life style recommendations revision. Nutr 114:82-96 https://www.academia.edu/20955325/Diet_and_Lifestyle_Recommendations_Revision_2006_A_Scientific_Statement_From_the_American_Heart_Association_Nutrition_Committee

AOAC (2003) Official methods of analysis of the Association of Analytical Chemistry, 15th edn. AOAC, Arlington, VA, USA

Apraku A, Liu L, Ayisi CL (2017) Trends and status of dietary coconut oil in aquaculture feeds. Rev Fish Sci Aquac 25:126-132 doi: 10.1080/23308249.2016.1245275

Ballestrazzi R, Rainis S, Maxia M (2006) The replacement of fish oil with refined coconut oil in the diet of large rainbow trout (Oncorhynchus mykiss). Ital J Anim Sci 5:155-164 doi: 10.4081/ijas.2006.155

Bjermo H, Iggman D, Kullberg J, Dahlman I, Johansson L, Persson L, Berglund J, Pulkki K, Basu S, Uusitupa M, Rudling M, Arner P, Cederholm T, Ahlstrom H, Riserus U (2012) Effects of n-6 PUFAs compared with SFAs on liver fat, lipoproteins, and inflammation in abdominal obesity: a randomized controlled trial. Am J Clin Nutr 95:1003-1012 doi: 10.3945/ajcn.111.030114

Blake WL, Clarke SD (1990) Suppression of rat hepatic fatty acid synthase and S14 gene transcription by dietary polyunsaturated fat. J Nutr 120:1727-1729 doi: 10.1093/jn/120.12.1727

Caballero MJ, Obach A, Rosenlund G, Montero D, Gisvold M, Izquierdo MS (2002) Impact of different dietary lipid sources on growth, lipid digestibility, tissue fatty acid composition and histology of rainbow trout Oncorhynchus mykiss. Aquaculture 214:253-271 doi: 10.1016/S0044-8486(01)00852-3

Cai ZN, Feng SH, Xiang XJ, Mai KS, Ai QH (2016) Effects of dietary phospholipid on lipase activity, antioxidant capacity and lipid metabolism-related gene expression in large yellow croaker larvae (larimichthys crocea). Comp Biochem Phys B. 201:46-52 http://www.wanfangdata.com.cn/details/detail.do?_type=perio&id=68925142afb3303eb3d08d75d144e2dd

Craig SR, Gatlin DM (1997) Growth and body composition of juvenile red drum (Sciaenops ocellatus) fed diets containing lecithin supplemental choline. Aquaculture 151:259-267 doi: 10.1016/S0044-8486(96)01479-2

Du JL, Xu H, Li SL, Cai ZN, Mai KS, Ai QH (2017) Effects of dietary chenodeoxycholic acid on growth performance, body composition and related gene expression in large yellow croaker (Larimichthys crocea) fed diets with high replacement of fish oil with soybean oil. Aquaculture 479:584-590 doi: 10.1016/j.aquaculture.2017.06.023

FAO (2012) The state of food and agriculture 2012. Investing Agric Better Future 79:572-574

Ferreri C, Chatgilialoglu C (2009) Membrane lipidomics and the geometry of unsaturated fatty acids from biomimetic models to biological consequences. Methods Mol Biol 579:391-411 http://cn.bing.com/academic/profile?id=9954413ee761685c5de715154b59a19e&encoded=0&v=paper_preview&mkt=zh-cn

Figueiredo-Silva AC, Kaushik S, Terrier F, Schrama JW, Médale F, Geurden I (2011) Link between lipid metabolism and voluntary food intake in rainbow trout fed coconut oil rich in medium-chain TAG. Br J Nutr 107:1714-1725 http://cn.bing.com/academic/profile?id=359235dfd9e9ed6ba10b70c6f12fad1d&encoded=0&v=paper_preview&mkt=zh-cn

Flatmark T, Nilsson A, Kvannes J, Eikhom TS, Fukami MH, Kryvi H, Christiansen EN (1988) On the mechanism of induction of the enzyme systems for peroxisomal β-oxidation of fatty acids in rat liver by diets rich in partially hydrogenated fish oil. BBA-Lipid Lipid Met 962:122-130 doi: 10.1016/0005-2760(88)90103-8

Fontagné S, Corraze G, Bergot P (2000) Tricaproin, tricaprin and trilaurin are utilized more efficiently than tricaprylin by carp (Cyprinus carpio L.) larvae. J Nutr 130:2009-2015 doi: 10.1093/jn/130.8.2009

James KAC, Thompson KG, Maccoll AJ, Booth CL, Body DR, Chirkov YY, Butler RC, Moughan PJ, Lubbe WF (2002) Platelet aggregation in pigs fed diets containing anhydrous milkfat, fish oil or hydrogenated coconut oil. Nutr Res 22:1281-1298 doi: 10.1016/S0271-5317(02)00425-6

Jin M, Yuan Y, Lu Y, Ma HN, Sun P, Li Y, Qiu H, Ding LY, Zhou QC (2017) Regulation of growth, tissue fatty acid composition, biochemical parameters and lipid related genes expression by different dietary lipid sources in juvenile black seabream, Acanthopagrus schlegelii. Aquaculture 479:25-37 doi: 10.1016/j.aquaculture.2017.05.017

Kadota Y, Toyoda T, Hayashi-Kato M, Kitaura Y, Shimomura Y (2015) Octanoic acid promotes branched-chain amino acid catabolisms via the inhibition of hepatic branched-chain alpha-keto acid dehydrogenase kinase in rats. Metabolism 64:1157-1164 doi: 10.1016/j.metabol.2015.05.014

Kanazawa A, Teshima S, Ono K (1979) Relationship between essential fatty acid requirements of aquatic animals and the capacity for bioconversion of linolenic acid to highly unsaturated fatty acid. Comp Biochem Phys B 63:295-298 doi: 10.1016/0305-0491(79)90251-7

Kersten S (2014) Integrated physiology and systems biology of PPAR-α. Mol Metab 3:354-371 doi: 10.1016/j.molmet.2014.02.002

Kralova LI, Suchanek P, Kovar J, Stavek P, Poledne R (2008) Replacement of dietary saturated FAs by PUFAs in diet and reverse cholesterol transport. J Lipid Res 49:2414-2418 doi: 10.1194/jlr.M800271-JLR200

Leaver MJ, Tocher DR, Obach A, Jensen L, Henderson RJ, Porter AR, Krey G (2006) Effect of dietary conjugated linoleic acid (CLA) on lipid composition, metabolism and gene expression in Atlantic salmon (Salmo salar) tissues. Comp Biochem Phys A 145:258-267 doi: 10.1016/j.cbpa.2006.06.034

Li DF, Thaler RC, Nelssen JL, Harmon DL, Allee GL, Weeden TL (1990) Effect of fat sources and combinations on starter pig performance, nutrient digestibility and intestinal morphology. J Anim Sci 68:3694-3704 doi: 10.2527/1990.68113694x

Li Q, Zhu H, Li E, Qin J, Chen L (2017) Growth performance, lipid requirement and antioxidant capacity of juvenile Russian sturgeon Acipenser gueldenstaedti fed various levels of linoleic and linolenic acids. Aquac Res 48:3216-3229 doi: 10.1111/are.13152

Li XS, Ji RL, Cui K, Chen QC, Chen Q, Fang W, Mai KS, Zhang YJ, Xu WQ, Ai QH (2019a) High percentage of dietary palm oil suppressed growth and antioxidant capacity and induced the inflammation by activation of TLR-NF-κB signaling pathway in large yellow croaker (Larimichthys crocea). Fish Shellfish Immunol 87:600-608 doi: 10.1016/j.fsi.2019.01.055

Li XS, Cui K, Fang W, Chen Q, Xu D, Mai KS, Zhang YJ, Ai QH (2019b) High level of dietary olive oil decreased growth, increased liver lipid deposition and induced inflammation by activating the p38 MAPK and JNK pathways in large yellow croaker (Larimichthys crocea). Fish Shellfish Immunol 94:157-165 doi: 10.1016/j.fsi.2019.08.062

López LM, Durazo E, Viana MT, Drawbridge M, Bureau DP (2009) Effect of dietary lipid levels on performance, body composition and fatty acid profile of juvenile white seabass, Atractoscion nobilis. Aquaculture 289:101-105 doi: 10.1016/j.aquaculture.2009.01.003

Machmüller A, Soliva CR, Kreuzer M (2003) Effect of coconut oil and defaunation treatment on methanogenesis in sheep. Reprod Nutr Dev 43:41-55 doi: 10.1051/rnd:2003005

Martínez-Alvarez RM, Hidalgo MC, Domezain A, Morales AE, García-Gallego M, Sanz A (2003) Physiological changes of sturgeon acipenser nacarii caused by increasing environmental salinity. J Exp Biol 205:3699-3706 https://www.ncbi.nlm.nih.gov/pubmed/12409496

Metcalfe LD, Schmitz AA, Pelka JR (1966) Rapid preparation of fatty acid esters from lipids for gas chromatographic analysis. Anal Chem 38:514-515 doi: 10.1021/ac60235a044

Mourente G, Bell JG, Tocher DR (2007) Does dietary tocopherol level affect fatty acid metabolism in fish? Fish Physiol Biochem 33:269-280 doi: 10.1007/s10695-007-9139-4

Nematipour GR, Gatlin DM (1993) Effects of different kinds of dietary lipid on growth and fatty acid composition of juvenile sunshine bass, Morone chrysops♀ M. saxatilis♂. Aquaculture 114:141-154 doi: 10.1016/0044-8486(93)90257-Y

Ning LJ, He AY, Li JM, Lu DL, Jiao JG, Li LY, Li DL, Zhang M, Chen LQ, Du ZY (2016) Mechanisms and metabolic regulation of PPARα activation in Nile tilapia (Oreochromis niloticus). BBA Mol Cell Biol L. 1861:1036-1048 doi: 10.1016/j.bbalip.2016.06.005

Özkan-Yilmaz F, Özlüer-Hunt A, Gündüz SG, Berköz M, Yalın S (2013) Effects of dietary selenium of organic form against lead toxicity on the antioxidant system in Cyprinus carpio. Fish Physiol Biochem 40:355-363 http://www.wanfangdata.com.cn/details/detail.do?_type=perio&id=90c61d204f12bb297df5f6493649e4f1

Peng X, Li F, Lin S, Chen Y (2016) Effects of total replacement of fish oil on growth performance, lipid metabolism and antioxidant capacity in tilapia (Oreochromis niloticus). Aquac Int 24:145-156 doi: 10.1007/s10499-015-9914-7

Røsjø C, Nordrum S, Olli JJ, Krogdahl Å, Ruyter B, Holm H (2000) Lipid digestibility and metabolism in Atlantic salmon (Salmo salar) fed medium-chain triglycerides. Aquaculture 190:65-76 doi: 10.1016/S0044-8486(00)00395-1

Smith S, Witkowski A, Joshi AK (2003) Structural and functional organization of the animal fatty acid synthase. Prog Lipid Res 42:289-317 doi: 10.1016/S0163-7827(02)00067-X

Smith DM, Williams IH, Williams KC, Barclay MC, Venables WN (2005) Oxidation of medium-chain and long-chain fatty acids by polka dot grouper Cromileptes altivelis. Aquac Nutr 11:41-48 doi: 10.1111/j.1365-2095.2004.00321.x

Souza-Mello V (2015) Peroxisome proliferator-activated receptors as targets to treat nonalcoholic fatty liver disease. World J Hepatol 7:1012 doi: 10.4254/wjh.v7.i8.1012

Tacon AGJ, Metian M (2008) Aquaculture feed and food safety. Ann N.Y. Acad Sci 1140:50-59 doi: 10.1196/annals.1454.003

Tan P, Dong XJ, Mai KS, Xu W, Ai QH (2016) Vegetable oil induced inflammatory response by altering TLR-NF-κB signalling, macrophages infiltration and polarization in adipose tissue of large yellow croaker (Larimichthys crocea). Fish Shellfish Immunol 59:398-405 doi: 10.1016/j.fsi.2016.11.009

Torstensen BE, Frøyland L, Ørnsrud R, Lie Ø (2004) Tailoring of a cardioprotective muscle fatty acid composition of Atlantic salmon (Salmo salar) fed vegetable oils. Food Chem 87:567-580 doi: 10.1016/j.foodchem.2004.01.009

Trushenski J, Schwarz M, Lewis H, Laporte J, Delbos B, Takeuchi R, Sampaio LA (2010) Effect of replacing dietary fish oil with soybean oil on production performance and fillet lipid and fatty acid composition of juvenile cobia Rachycentron canadum. Aquac Nutr 17:437-447 http://www.wanfangdata.com.cn/details/detail.do?_type=perio&id=df4a3ebd386fd10829e1776f70a6d8b4

Tseng YY, Lin YH (2020) Effects of dietary supplementation with coconut oil on the growth, fatty acid profiles and some lipid metabolism relative gene expressions of orange-spotted grouper (Epinephelus coioides). Aquac Nutr 26:201-210 doi: 10.1111/anu.12981

Turchini GM, Torstensen BE, Ng WK (2009) Fish oil replacement in finfish nutrition. Rev Aquac 1:10-57 doi: 10.1111/j.1753-5131.2008.01001.x

Villarino BJ, Dy LM, Lizada MCC (2007) Descriptive sensory evaluation of virgin coconut oil and refined, bleached and deodorized coconut oil. Food Sci Technol 40:193-199 http://www.wanfangdata.com.cn/details/detail.do?_type=perio&id=65eede42228d8411c569215a6eb0c94d

Wang L, Lu Q, Luo S, Zhan W, Chen R, Lou B, Xu D (2016) Effect of dietary lipid on growth performance, body composition, plasma biochemical parameters and liver fatty acids content of juvenile yellow drum Nibea albiflora. Aquac Rep 4:10-16 doi: 10.1016/j.aqrep.2016.05.002

Watanabe T (1982) Lipid nutrition in fish. Comp Biochem Physiol B 73:3-15 doi: 10.1016/0305-0491(82)90196-1

Winzer K, Becker W, Noorden CJF, Köhler A (2000) Short-time induction of oxidative stress in hepatocytes of the European flounder (Platichthys flesus). Mar Environ Res 50:495-501 doi: 10.1016/S0141-1136(00)00124-0

Wood C (1999) Free radicals in biology and medicine. Int J Biochem Cell Biol 31:1454 doi: 10.1016/S1357-2725(99)00059-X

Xu J, Qin J, Yan B, Zhu M, Luo G (2011) Effects of dietary lipid levels on growth performance, feed utilization and fatty acid composition of juvenile Japanese seabass (Lateolabrax japonicus) reared in seawater. Aquac Int 19:79-89 doi: 10.1007/s10499-010-9342-7

Yan J, Liao K, Wang TJ, Mai KS, Ai QH (2015) Dietary lipid levels influence lipid deposition in the liver of large yellow croaker (larimichthys crocea) by regulating lipoprotein receptors, fatty acid uptake and triacylglycerol synthesis and catabolism at the transcriptional level. PLoS One 10(6):e0129937 doi: 10.1371/journal.pone.0129937

Zuo RT, Ai QH, Mai KS, Xu W, Wang J, Xu HG, Liufu ZG, Zhang YJ (2012) Effects of dietary docosahexaenoic to eicosapentaenoic acid ratio (DHA/EPA) on growth, nonspecific immunity, expression of some immune related genes and disease resistance of large yellow croaker (Larmichthys crocea) following natural infestation of parasites (Cryptocaryon irritans). Aquaculture 334:101-109 http://www.wanfangdata.com.cn/details/detail.do?_type=perio&id=b3a30ffbbd920f659312b01bea0854c0

Zuo RT, Mai KS, Xu W, Turchini GM, Ai QH (2015) Dietary ALA, but not LNA, increase growth, reduce inflammatory processes, and increase anti-oxidant capacity in the marine finfish Larimichthys crocea. Lipids 50:149-163 doi: 10.1007/s11745-014-3970-z

Supplements (0)

Cited By

Figures(2) / Tables(8)

Get Citation

PDF

XML

Article Metrics

Article views (1187) PDF downloads (5)

Optimal amounts of coconut oil in diets improve the growth, antioxidant capacity and lipid metabolism of large yellow croaker (Larimichthys crocea)