+Advanced Search
Volume 2 Issue 2
May  2020
Article Contents

Citation:

Functional analysis of the methyltransferase SMYD in the single-cell model organism Tetrahymena thermophila

  • Received Date: 2019-08-15
    Accepted Date: 2019-10-15
    Published online: 2020-03-05
  • Edited by Jiamei Li.
  • Lysine methylation of histones and non-histones plays a pivotal role in diverse cellular processes. The SMYD (SET and MYND domain) family methyltransferases can methylate various histone and non-histone substrates in mammalian systems, implicated in HSP90 methylation, myofilament organization, cancer inhibition, and gene transcription regulation. To resolve controversies concerning SMYD's substrates and functions, we studied SMYD1 (TTHERM_00578660), the only homologue of SMYD in the unicellular eukaryote Tetrahymena thermophila. We epitope-tagged SMYD1, and analyzed its localization and interactome. We also characterized ΔSMYD1 cells, focusing on the replication and transcription phenotype. Our results show that: (1) SMYD1 is present in both cytoplasm and transcriptionally active macronucleus and shuttles between cytoplasm and macronucleus, suggesting its potential association with both histone and non-histone substrates; (2) SMYD1 is involved in DNA replication and regulates transcription of metabolism-related genes; (3) HSP90 is a potential substrate for SMYD1 and it may regulate target selection of HSP90, leading to pleiotropic effects in both the cytoplasm and the nucleus.
  • 加载中
  • Abu-Farha M, Lambert JP, Al-Madhoun AS, Elisma F, Skerjanc IS, Figeys D (2008) The tale of two domains proteomics and genomics analysis of SMYD2, a new histone methyltransferase. Mol Cell Proteomics 7:560-572 doi: 10.1074/mcp.M700271-MCP200
    Abu-Farha M, Lanouette S, Elisma F, Tremblay V, Butson J, Figeys D, Couture JF (2011) Proteomic analyses of the SMYD family interactomes identify HSP90 as a novel target for SMYD2. J Mol Cell Bol 3:301-308 doi: 10.1093/jmcb/mjr025
    Adl SM, Simpson AG, Lane CE, Lukes J, Bass D, Bowser SS, Brown MW, Burki F, Dunthorn M, Hampl V, Heiss A, Hoppenrath M, Lara E, Le Gall L, Lynn DH, McManus H, Mitchell EA, Mozley-Stanridge SE, Parfrey LW, Pawlowski J et al (2012) The revised classification of eukaryotes. J Eukaryot Microbiol 59:429-493 doi: 10.1111/j.1550-7408.2012.00644.x
    Allis CD, Caparros M, Jenuwein T, Reinberg D (2015) Epigenetics, 2nd edn. Cold Spring Harbor Laboratory Press, New York
    Al-Shar'i NA, Alnabulsi SM (2016) Explaining the autoinhibition of the SMYD enzyme family: a theoretical study. J Mol Graph Model 68:147-157 doi: 10.1016/j.jmgm.2016.07.001
    Arsenault PR, Song D, Chung YJ, Khurana TS, Lee FS (2016) The zinc finger of prolyl hydroxylase domain protein 2 is essential for efficient hydroxylation of hypoxia-inducible factor α. Mol Cell Biol 36:2328-2343 doi: 10.1128/MCB.00090-16
    Bachman AB, Keramisanou D, Xu W, Beebe K, Moses MA, Kumar MV, Gray G, Noor RE, van der Vaart A, Neckers L (2018) Phosphorylation induced cochaperone unfolding promotes kinase recruitment and client class-specific Hsp90 phosphorylation. Nat Commun 9:265 doi: 10.1038/s41467-017-02711-w
    Bagislar S, Sabò A, Kress TR, Doni M, Nicoli P, Campaner S, Amati B (2016) Smyd2 is a Myc-regulated gene critical for MLL-AF9 induced leukemogenesis. Oncotarget 7:66398-66415
    Black JC, Van Rechem C, Whetstine JR (2012) Histone lysine methylation dynamics: establishment, regulation, and biological impact. Mol Cell 48:491-507 doi: 10.1016/j.molcel.2012.11.006
    Blanc RS, Richard S (2017) Arginine methylation: the coming of age. Mol Cell 65:8-24 doi: 10.1016/j.molcel.2016.11.003
    Boehm D, Jeng M, Camus G, Gramatica A, Schwarzer R, Johnson JR, Hull PA, Montano M, Sakane N, Pagans S (2017) SMYD2-mediated histone methylation contributes to HIV-1 latency. Cell Host Microbe 21:569-579 doi: 10.1016/j.chom.2017.04.011
    Brown MA, Sims RJ, Gottlieb PD, Tucker PW (2006) Identification and characterization of Smyd2: a split SET/MYND domain-containing histone H3 lysine 36-specific methyltransferase that interacts with the Sin3 histone deacetylase complex. Mol Cancer 5:1 
    Buuh ZY, Lyu Z, Wang RE (2017) Interrogating the roles of post-translational modifications of non-histone proteins. J Med Chem 61:3239-3252 
    Calpena E, Palau F, Espinós C, Galindo MI (2015) Evolutionary history of the smyd gene family in metazoans: a framework to identify the orthologs of human smyd genes in Drosophila and other animal species. PLoS ONE 10:e0134106 doi: 10.1371/journal.pone.0134106
    Cao XJ, Arnaudo AM, Garcia BA (2013) Large-scale global identification of protein lysine methylation in vivo. Epigenetics 8:477-485 doi: 10.4161/epi.24547
    Cassidy-Hanley D, Bowen J, Lee JH, Cole E, VerPlank LA, Gaertig J, Gorovsky MA, Bruns PJ (1997) Germline and somatic transformation of mating Tetrahymena thermophila by particle bombardment. Genetics 146:135-147 
    Chen X, Bracht JR, Goldman AD, Dolzhenko E, Clay DM, Swart EC, Perlman DH, Doak TG, Stuart A, Amemiya CT, Sebra RP, Landweber LF (2014) The architecture of a scrambled genome reveals massive levels of genomic rearrangement during development. Cell 158:1187-1198 doi: 10.1016/j.cell.2014.07.034
    Chen X, Gao S, Liu YF, Wang YY, Wang YR, Song WB (2016) Enzymatic and chemical mapping of nucleosome distribution in purified micro-and macronuclei of the ciliated model organism, Tetrahymena thermophila. Sci China Life Sci 59:909-919 doi: 10.1007/s11427-016-5102-x
    Chen Y, Tsai CH, Wang PY, Teng SC (2017) SMYD3 promotes homologous recombination via regulation of H3K4-mediated gene expression. Sci Rep 7:3842 doi: 10.1038/s41598-017-03385-6
    Chen X, Wang YY, Sheng YL, Warren A, Gao S (2018) GPSit: an automated method for evolutionary analysis of nonculturable ciliated microeukaryotes. Mol Ecol Resour 18:700-713 doi: 10.1111/1755-0998.12750
    Chen X, Jiang YH, Gao F, Zheng WB, Krock TJ, Stover NA, Lu C, Katz LA, Song WB (2019) Genome analyses of the new model protist Euplotes vannus focusing on genome rearrangement and resistance to environmental stressors. Mol Ecol Resour 19:1292-1308 doi: 10.1111/1755-0998.13023
    Cheng CY, Young JM, Lin CYG, Chao JL, Malik HS, Yao MC (2016) The piggyBac transposon-derived genes TPB1 and TPB6 mediate essential transposon-like excision during the developmental rearrangement of key genes in Tetrahymena thermophila. Gene Dev 30:2724-2736 doi: 10.1101/gad.290460.116
    Chuikov S, Kurash JK, Wilson JR, Xiao B, Justin N, Ivanov GS, McKinney K, Tempst P, Prives C, Gamblin SJ (2004) Regulation of p53 activity through lysine methylation. Nature 432:353-360 doi: 10.1038/nature03117
    Darriba D, Taboada GL, Doallo R, Posada D (2011) ProtTest 3: fast selection of best-fit models of protein evolution. Bioinformatics 27:1164-1165 doi: 10.1093/bioinformatics/btr088
    Diehl F, Brown MA, Van Amerongen MJ, Novoyatleva T, Wietelmann A, Harriss J, Ferrazzi F, Böttger T, Harvey RP, Tucker PW, Engel FB (2010) Cardiac deletion of Smyd2 is dispensable for mouse heart development. PLoS ONE 5:e9748 doi: 10.1371/journal.pone.0009748
    Donlin LT, Andresen C, Just S, Rudensky E, Pappas CT, Kruger M, Jacobs EY, Unger A, Zieseniss A, Dobenecker MW, Voelkel T, Chait BT, Gregorio CC, Rottbauer W, Tarakhovsky A, Linke WA (2012) Smyd2 controls cytoplasmic lysine methylation of Hsp90 and myofilament organization. Genes Dev 26:114-119 doi: 10.1101/gad.177758.111
    Du SJ, Tan X, Zhang J (2014) SMYD proteins: key regulators in skeletal and cardiac muscle development and function. Anat Rec 297:1650-1662 doi: 10.1002/ar.22972
    Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32:1792-1797 doi: 10.1093/nar/gkh340
    Edwards JR, Yarychkivska O, Boulard M, Bestor TH (2017) DNA methylation and DNA methyltransferases. Epigenet Chromatin 10:23 doi: 10.1186/s13072-017-0130-8
    Feng LF, Wang GY, Hamilton EP, Xiong J, Yan GX, Chen K, Chen X, Dui W, Plemens A, Khadr L (2017) A germline-limited piggyBac transposase gene is required for precise excision in Tetrahymena genome rearrangement. Nucleic Acids Res 45:9481-9502 doi: 10.1093/nar/gkx652
    Gao S, Xiong J, Zhang CC, Berquist BR, Yang RD, Zhao M, Molascon AJ, Kwiatkowski SY, Yuan DX, Qin ZH, Wen JF, Kapler GM, Andrews PC, Miao W, Liu YF (2013) Impaired replication elongation in Tetrahymena mutants deficient in histone H3 Lys 27 monomethylation. Genes Dev 27:1662-1679 doi: 10.1101/gad.218966.113
    Gao F, Warren A, Zhang QQ, Gong J, Miao M, Sun P, Xu DP, Huang J, Yi ZZ, Song WB (2016) The all-data-based evolutionary hypothesis of ciliated protists with a revised classification of the phylum Ciliophora (Eukaryota, Alveolata). Sci Rep 6:24874 doi: 10.1038/srep24874
    Giakountis A, Moulos P, Sarris ME, Hatzis P, Talianidis I (2017) Smyd3-associated regulatory pathways in cancer. Semin Cancer Biol 42:70-80 doi: 10.1016/j.semcancer.2016.08.008
    Goldberg AD, Allis CD, Bernstein E (2007) Epigenetics: a landscape takes shape. Cell 128:635-638 doi: 10.1016/j.cell.2007.02.006
    Gordon A, Hannon G (2010) Fastx-toolkit. FASTQ/A short-reads pre-processing tools. Unpublished Available online at: http://hannonlab.cshl.edu/fastx_toolkit/
    Gottlieb PD, Pierce SA, Sims RJ, Yamagishi H, Weihe EK, Harriss JV, Maika SD, Kuziel WA, King HL, Olson EN (2002) Bop encodes a muscle-restricted protein containing MYND and SET domains and is essential for cardiac differentiation and morphogenesis. Nat Genet 31:25-32 doi: 10.1038/ng866
    Guerin F, Arnaiz O, Boggetto N, Denby Wilkes C, Meyer E, Sperling L, Duharcourt S (2017) Flow cytometry sorting of nuclei enables the first global characterization of Paramecium germline DNA and transposable elements. BMC Genom 18:327 doi: 10.1186/s12864-017-3713-7
    Guillemette B, Drogaris P, Lin HHS, Armstrong H, Hiragami-Hamada K, Imhof A, Bonneil E, Thibault P, Verreault A, Festenstein RJ (2011) H3 lysine 4 is acetylated at active gene promoters and is regulated by H3 lysine 4 methylation. PLoS Genet 7:e1001354 doi: 10.1371/journal.pgen.1001354
    Hamamoto R, Furukawa Y, Morita M, Iimura Y, Silva FP, Li M, Yagyu R, Nakamura Y (2004) SMYD3 encodes a histone methyltransferase involved in the proliferation of cancer cells. Nat Cell Biol 6:731-740 doi: 10.1038/ncb1151
    Hamamoto R, Toyokawa G, Nakakido M, Ueda K, Nakamura Y (2014) SMYD2-dependent HSP90 methylation promotes cancer cell proliferation by regulating the chaperone complex formation. Cancer Lett 351:126-133 doi: 10.1016/j.canlet.2014.05.014
    Hamamoto R, Saloura V, Nakamura Y (2015) Critical roles of non-histone protein lysine methylation in human tumorigenesis. Nat Rev Cancer 15:110-124 doi: 10.1038/nrc3884
    Hamilton EP, Kapusta A, Huvos PE, Bidwell SL, Zafar N, Tang H, Hadjithomas M, Krishnakumar V, Badger JH, Caler EV, Russ C, Zeng Q, Fan L, Levin JZ, Shea T, Young SK, Hegarty R, Daza R, Gujja S, Wortman JR et al (2016) Structure of the germline genome of Tetrahymena thermophila and relationship to the massively rearranged somatic genome. eLife 5:e19090 doi: 10.7554/eLife.19090
    Herz HM, Garruss A, Shilatifard A (2013) SET for life: biochemical activities and biological functions of SET domain-containing proteins. Trends Biochem Sci 38:621-639 doi: 10.1016/j.tibs.2013.09.004
    Hu LP, Zhu YT, Qi C, Zhu YJ (2009) Identification of smyd4 as a potential tumor suppressor gene involved in breast cancer development. Cancer Res 69:4067-4072 doi: 10.1158/0008-5472.CAN-08-4097
    Huang J, Perez-Burgos L, Placek BJ, Sengupta R, Richter M, Dorsey JA, Kubicek S, Opravil S, Jenuwein T, Berger SL (2006) Repression of p53 activity by Smyd2-mediated methylation. Nature 444:629-632 doi: 10.1038/nature05287
    Huang JB, Zhang TT, Zhang QQ, Li Y, Warren A, Pan HB, Yan Y (2018) Further insights into the highly derived haptorids (Ciliophora, Litostomatea): phylogeny based on multigene data. Zool Scr 47:231-242 doi: 10.1111/zsc.12269
    Hubert Á, Mitani Y, Tamura T, Boicu M, Nagy I (2014) Protein complex purification from Thermoplasma acidophilum using a phage display library. J Microbiol Meth 98:15-22 doi: 10.1016/j.mimet.2013.12.010
    Hughes MA, Langlais C, Cain K, MacFarlane M (2013) Isolation, characterisation and reconstitution of cell death signalling complexes. Methods 61:98-104 doi: 10.1016/j.ymeth.2013.02.006
    Ivanov GS, Ivanova T, Kurash J, Ivanov A, Chuikov S, Gizatullin F, Herrera-Medina EM, Rauscher F, Reinberg D, Barlev NA (2007) Methylation-acetylation interplay activates p53 in response to DNA damage. Mol Cell Biol 27:6756-6769 doi: 10.1128/MCB.00460-07
    Jakobsson ME, Małecki J, Nilges BS, Moen A, Leidel SA, Falnes Pø (2017) Methylation of human eukaryotic elongation factor alpha (eEF1A) by a member of a novel protein lysine methyltransferase family modulates mRNA translation. Nucleic Acids Res 45:8239-8254 doi: 10.1093/nar/gkx432
    Jiang YY, Sirinupong N, Brunzelle J, Yang Z (2011) Crystal structures of histone and p53 methyltransferase SmyD2 reveal a conformational flexibility of the autoinhibitory C-terminal domain. PLoS ONE 6:e21640 doi: 10.1371/journal.pone.0021640
    Jiang F, Liu Q, Wang YL, Zhang J, Wang HM, Song TQ, Yang ML, Wang XH, Kang L (2017) Comparative genomic analysis of SET domain family reveals the origin, expansion, and putative function of the arthropod-specific SmydA genes as histone modifiers in insects. GigaScience 6:1-16 
    Karras GI, Yi S, Sahni N, Fischer M, Xie J, Vidal M, D'Andrea AD, Whitesell L, Lindquist S (2017) HSP90 shapes the consequences of human genetic variation. Cell 168:856-866 doi: 10.1016/j.cell.2017.01.023
    Kohl M, Wiese S, Warscheid B (2011) Cytoscape: software for visualization and analysis of biological networks. Methods Mol Biol 696:291-303 
    Lanouette S, Mongeon V, Figeys D, Couture JF (2014) The functional diversity of protein lysine methylation. Mol Syst Biol 10:724 doi: 10.1002/msb.134974
    Leinhart K, Brown M (2011) SET/MYND lysine methyltransferases regulate gene transcription and protein activity. Genes 2:210-218 doi: 10.3390/genes2010210
    Levine AJ, Berger SL (2017) The interplay between epigenetic changes and the p53 protein in stem cells. Genes Dev 31:1195-1201 doi: 10.1101/gad.298984.117
    Li B, Dewey CN (2011) RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 12:323 doi: 10.1186/1471-2105-12-323
    Li LX, Fan LX, Zhou JX, Grantham JJ, Calvet JP, Sage J, Li XG (2017) Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease. J Clin Invest 127:2751-2764 doi: 10.1172/JCI90921
    Liu YF, Taverna SD, Muratore TL, Shabanowitz J, Hunt DF, Allis CD (2007) RNAi-dependent H3K27 methylation is required for heterochromatin formation and DNA elimination in Tetrahymena. Genes Dev 21:1530-1545 doi: 10.1101/gad.1544207
    Liu XS, Wu H, Ji X, Stelzer Y, Wu X, Czauderna S, Shu J, Dadon D, Young RA, Jaenisch R (2016) Editing DNA methylation in the mammalian genome. Cell 167:233-247 doi: 10.1016/j.cell.2016.08.056
    Luo XT, Yan Y, Shao C, Al-Farraj SA, Bourland WA, Song WB (2018) Morphological, ontogenetic and molecular data support strongylidiids as being closely related to Dorsomarginalia (Protozoa, Ciliophora) and reactivation of the family Strongylidiidae Fauré-Fremiet, 1961. Zool J Linn Soc-Lond 184:237-254 doi: 10.1093/zoolinnean/zly001
    Maere S, Heymans K, Kuiper M (2005) BiNGO: a Cytoscape plugin to assess overrepresentation of gene ontology categories in biological networks. Bioinformatics 21:3448-3449 doi: 10.1093/bioinformatics/bti551
    Mao FB, Liu Q, Zhao XL, Yang HN, Guo S, Xiao LY, Li XF, Teng HJ, Sun ZS, Dou YL (2018) EpiDenovo: a platform for linking regulatory de novo mutations to developmental epigenetics and diseases. Nucleic Acids Res 46:D92-D99 doi: 10.1093/nar/gkx918
    Mar JC, Wells CA, Quackenbush J (2011) Defining an informativeness metric for clustering gene expression data. Bioinformatics 27:1094-1100 doi: 10.1093/bioinformatics/btr074
    Mazur PK, Reynoird N, Khatri P, Jansen PW, Wilkinson AW, Liu S, Barbash O, Van Aller GS, Huddleston M, Dhanak D, Tummino PJ, Kruger RG, Garcia BA, Butte AJ, Vermeulen M, Sage J, Gozani O (2014) SMYD3 links lysine methylation of MAP3K2 to Ras-driven cancer. Nature 510:283-287 doi: 10.1038/nature13320
    Mazur PK, Gozani O, Sage J, Reynoird N (2016) Novel insights into the oncogenic function of the SMYD3 lysine methyltransferase. Transl Cancer Res 5:330-333 doi: 10.21037/tcr.2016.06.26
    Miao W, Xiong J, Bowen J, Wang W, Liu Y, Braguinets O, Grigull J, Pearlman RE, Orias E, Gorovsky MA (2009) Microarray analyses of gene expression during the Tetrahymena thermophila life cycle. PLoS ONE 4:e4429 doi: 10.1371/journal.pone.0004429
    Miller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In: Gateway computing environments workshop, Institute of Electrical and Electronics Engineers, New Orleans, Louisiana
    Moore KE, Gozani O (2014) An unexpected journey: lysine methylation across the proteome. BBA Gene Regul Mech 1839:1395-1403 
    Noto T, Mochizuki K (2017) Whats, hows and whys of programmed DNA elimination in Tetrahymena. Open Biol 7:170172 doi: 10.1098/rsob.170172
    Noto T, Kataoka K, Suhren JH, Hayashi A, Woolcock KJ, Gorovsky MA, Mochizuki K (2015) Small-RNA-mediated genome-wide trans-recognition network in Tetrahymena DNA elimination. Mol Cell 59:229-242 doi: 10.1016/j.molcel.2015.05.024
    Ohtomo-Oda R, Komatsu S, Mori T, Sekine S, Hirajima S, Yoshimoto S, Kanai Y, Otsuji E, Ikeda E, Tsuda H (2016) SMYD2 overexpression is associated with tumor cell proliferation and a worse outcome in human papillomavirus-unrelated nonmultiple head and neck carcinomas. Hum Pathol 49:145-155 doi: 10.1016/j.humpath.2015.08.025
    Orias E, Hamilton EP, Orias JD (1999) Tetrahymena as a laboratory organism: useful strains, cell culture, and cell line maintenance. Methods Cell Biol 62:189-211 doi: 10.1016/S0091-679X(08)61530-7
    Qian C, Zhou MM (2006) SET domain protein lysine methyltransferases: structure, specificity and catalysis. Cell Mol Life Sci 63:2755-2763 doi: 10.1007/s00018-006-6274-5
    Ramadoss S, Guo G, Wang CY (2017) Lysine demethylase KDM3A regulates breast cancer cell invasion and apoptosis by targeting histone and the non-histone protein p53. Oncogene 36:47-59 doi: 10.1038/onc.2016.174
    Rasmussen TL, Ma Y, Park CY, Harriss J, Pierce SA, Dekker JD, Valenzuela N, Srivastava D, Schwartz RJ, Stewart MD (2015) Smyd1 facilitates heart development by antagonizing oxidative and ER stress responses. PLoS ONE 10:e0121765 doi: 10.1371/journal.pone.0121765
    Sheng YL, He M, Zhao FQ, Shao C, Miao M (2018) Phylogenetic relationship analyses of complicated class Spirotrichea based on transcriptomes from three diverse microbial eukaryotes: Uroleptopsis citrina, Euplotes vannus and Protocruzia tuzeti. Mol Phylogenet Evol 129:338-345 doi: 10.1016/j.ympev.2018.06.025
    Sima S, Richter K (2018) Regulation of the Hsp90 system. Biochem Biophys Acta 1865:889-897 doi: 10.1016/j.bbamcr.2018.03.008
    Sirinupong N, Brunzelle J, Ye J, Pirzada A, Nico L, Yang Z (2010) Crystal structure of cardiac-specific histone methyltransferase SmyD1 reveals unusual active site architecture. J Biol Chem 285:40635-40644 doi: 10.1074/jbc.M110.168187
    Sirinupong N, Brunzelle J, Doko E, Yang Z (2011) Structural insights into the autoinhibition and posttranslational activation of histone methyltransferase SmyD3. J Mol Biol 406:149-159 doi: 10.1016/j.jmb.2010.12.014
    Spellmon N, Holcomb J, Trescott L, Sirinupong N, Yang Z (2015) Structure and function of SET and MYND domain-containing proteins. Int J Mol Sci 16:1406-1428 doi: 10.3390/ijms16011406
    Spellmon N, Sun X, Xue W, Holcomb J, Chakravarthy S, Shang W, Edwards B, Sirinupong N, Li C, Yang Z (2017) New open conformation of SMYD3 implicates conformational selection and allostery. AIMS Biophys 4:1-18 
    Stamatakis A (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22:2688-2690 doi: 10.1093/bioinformatics/btl446
    Stamatakis A, Hoover P, Rougemont J (2008) A rapid bootstrap algorithm for the RAxML web servers. Syst Biol 57:758-771 doi: 10.1080/10635150802429642
    Stender JD, Pascual G, Liu W, Kaikkonen MU, Do K, Spann NJ, Boutros M, Perrimon N, Rosenfeld MG, Glass CK (2012) Control of proinflammatory gene programs by regulated trimethylation and demethylation of histone H4K20. Mol Cell 48:28-38 doi: 10.1016/j.molcel.2012.07.020
    Strzyz P (2016) Non-coding RNA: 7SK dampens transcription at super-enhancers. Nat Rev Mol Cell Biol 17:202 
    Taipale M, Jarosz DF, Lindquist S (2010) HSP90 at the hub of protein homeostasis: emerging mechanistic insights. Nat Rev Mol Cell Biol 11:515-528 doi: 10.1038/nrm2918
    Thompson EC, Travers AA (2008) A Drosophila Smyd4 homologue is a muscle-specific transcriptional modulator involved in development. PLoS ONE 3:e3008 doi: 10.1371/journal.pone.0003008
    Tracy C, Warren JS, Szulik M, Wang L, Garcia J, Makaju A, Russell K, Miller M, Franklin S (2018) The smyd family of methyltransferases: role in cardiac and skeletal muscle physiology and pathology. Curr Opin Microbiol 1:140-152 
    Voelkel T, Andresen C, Unger A, Just S, Rottbauer W, Linke WA (2013) Lysine methyltransferase Smyd2 regulates Hsp90-mediated protection of the sarcomeric titin springs and cardiac function. BBA Mol Cell Res 1833:812-822 
    Walter J, Hümpel A (2017) Introduction to epigenetics. In: Heil R, Seitz S, König H, Robienski J (eds) Epigenetics, futures of technology, science and society. Springer, Wiesbaden, pp 11-29
    Wang Q, Wang KY, Ye ML (2017a) Strategies for large-scale analysis of non-histone protein methylation by LC-MS/MS. Analyst 142:3536-3548 doi: 10.1039/C7AN00954B
    Wang YR, Wang YY, Sheng YL, Huang JB, Chen X, Al-Rasheid KAS, Gao S (2017b) A comparative study of genome organization and epigenetic mechanisms in model ciliates, with an emphasis on Tetrahymena, Paramecium and Oxytricha. Eur J Protistol 61:376-387 doi: 10.1016/j.ejop.2017.06.006
    Wang YY, Chen X, Sheng YL, Liu YF, Gao S (2017c) N6-adenine DNA methylation is associated with the linker DNA of H2A. Z-containing well-positioned nucleosomes in Pol Ⅱ-transcribed genes in Tetrahymena. Nucleic Acids Res 45:11594-11606 doi: 10.1093/nar/gkx883
    Wang YY, Sheng YL, Liu YF, Pan B, Huang JB, Warren A, Gao S (2017d) N6-methyladenine DNA modification in the unicellular eukaryotic organism Tetrahymena thermophila. Eur J Protistol 58:94-102 doi: 10.1016/j.ejop.2016.12.003
    Wang YR, Wang CD, Jiang YH, Katz LA, Gao F, Yan Y (2019) Further analyses of variation of ribosome DNA copy number and polymorphism in ciliates provide insights relevant to studies of both molecular ecology and phylogeny. Sci China Life Sci 62:203-214 doi: 10.1007/s11427-018-9422-5
    Wickham H (2016) ggplot2: elegant graphics for data analysis, 2nd edn. Springer, New York
    Woehrer SL, Aronica L, Suhren JH, Busch CJL, Noto T, Mochizuki K (2015) A Tetrahymena Hsp90 co-chaperone promotes siRNA loading by ATP-dependent and ATP-independent mechanisms. EMBO J 34:559-577 doi: 10.15252/embj.201490062
    Wozniak GG, Strahl BD (2014) Hitting the "mark": interpreting lysine methylation in the context of active transcription. BBA Gene Regul Mech 1839:1353-1361 
    Wu LP, Lee SY, Zhou B, Nguyen UT, Muir TW, Tan S, Dou YL (2013) ASH2L regulates ubiquitylation signaling to MLL: trans-regulation of H3 K4 methylation in higher eukaryotes. Mol Cell 49:1108-1120 doi: 10.1016/j.molcel.2013.01.033
    Xiong J, Lu YM, Feng JM, Yuan DX, Tian M, Chang Y, Fu CJ, Wang GY, Zeng HH, Miao W (2013) Tetrahymena functional genomics database (TetraFGD): an integrated resource for Tetrahymena functional genomics. Database. https://doi.org/10.1093/database/bat008
    Xu J, Bo T, Song WB, Wang W (2019a) Metabolomic fingerprint of the model ciliate, Tetrahymena thermophila determined by untargeted profiling using gas chromatography-mass spectrometry. J Ocean Univ China 18:654-662 doi: 10.1007/s11802-019-3974-7
    Xu J, Li X, Song WB, Wang W, Gao S (2019b) Cyclin Cyc2 is required for elongation of meiotic micronucleus in the unicellular eukaryotic model organism Tetrahymena thermophila. Sci China Life Sci 62:668-680 doi: 10.1007/s11427-018-9369-3
    Yan Y, Fan YB, Luo XT, El-Serehy HA, Bourland W, Chen XR (2018) New contribution to the species-rich genus Euplotes: morphology, ontogeny and systematic position of two species (Ciliophora; Euplotia). Eur J Protistol 64:20-39 doi: 10.1016/j.ejop.2018.03.003
    Yi X, Jiang XJ, Li XY, Jiang DS (2017) Histone lysine methylation and congenital heart disease: from bench to bedside. Int J Mol Med 40:953-964 doi: 10.3892/ijmm.2017.3115
    Zhang XD, Huang L, Wu T, Feng YF, Ding YY, Ye PF, Yin ZJ (2015) Transcriptomic analysis of ovaries from pigs with high and low litter size. PLoS ONE 10:e0139514 doi: 10.1371/journal.pone.0139514
    Zhang TT, Wang CD, Laura AK, Gao F (2018) A paradox: rapid evolution rates of germline-limited sequences are associated with conserved patterns of rearrangements in cryptic species of Chilodonella uncinata (Protist, Ciliophora). Sci China Life Sci 61:1071-1078 doi: 10.1007/s11427-018-9333-1
    Zhao XL, Wang YY, Wang YR, Liu YF, Gao S (2017) Histone methyltransferase TXR1 is required for both H3 and H3. 3 lysine 27 methylation in the well-known ciliated protist Tetrahymena thermophila. Sci China Life Sci 60:264-270 
    Zhao Y, Yi ZZ, Warren A, Song W (2018) Species delimitation for the molecular taxonomy and ecology of the widely distributed microbial eukaryote genus Euplotes (Alveolata, Ciliophora). Proc Biol Sci 285:20172159 doi: 10.1098/rspb.2017.2159
    Zhao XL, Xiong J, Mao FB, Sheng YL, Chen X, Feng LF, Dui W, Yang WT, Kapusta A, Feschotte C (2019) RNAi-dependent Polycomb repression controls transposable elements in Tetrahymena. Genes Dev 33:348-364 doi: 10.1101/gad.320796.118
    Zheng WB, Wang CD, Yan Y, Gao F, Doak TG, Song WB (2018) Insights into an extensively fragmented eukaryotic genome: de novo genome sequencing of the multinuclear ciliate Uroleptopsis citrina. Genome Biol Evol 10:883-894 doi: 10.1093/gbe/evy055
    Zhou B, Wang JY, Lee SY, Xiong J, Bhanu N, Guo Q, Ma PL, Sun YQ, Rao RC, Garcia BA (2016) PRDM16 suppresses MLL1r leukemia via intrinsic histone methyltransferase activity. Mol Cell 62:222-236 doi: 10.1016/j.molcel.2016.03.010
    Zhu Y, Zhu MX, Zhang XD, Xu XE, Wu ZY, Liao LD, Li LY, Xie YM, Wu JY, Zou HY (2016) SMYD3 stimulates EZR and LOXL2 transcription to enhance proliferation, migration, and invasion in esophageal squamous cell carcinoma. Hum Pathol 52:153-163 doi: 10.1016/j.humpath.2016.01.012
  • 加载中
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Figures(5) / Tables(4)

Article Metrics

Article views(677) PDF downloads(13) Cited by()

Related
Proportional views

Functional analysis of the methyltransferase SMYD in the single-cell model organism Tetrahymena thermophila

  • 1. Institute of Evolution and Marine Biodiversity, Ocean University of China, Qingdao 266003, China
  • 2. Department of Pathology, University of Michigan, Ann Arbor, MI 48109, USA
  • 3. Laboratory for Marine Biology and Biotechnology, Qingdao National Laboratory for Marine Science and Technology, Qingdao 266003, China

Abstract: Lysine methylation of histones and non-histones plays a pivotal role in diverse cellular processes. The SMYD (SET and MYND domain) family methyltransferases can methylate various histone and non-histone substrates in mammalian systems, implicated in HSP90 methylation, myofilament organization, cancer inhibition, and gene transcription regulation. To resolve controversies concerning SMYD's substrates and functions, we studied SMYD1 (TTHERM_00578660), the only homologue of SMYD in the unicellular eukaryote Tetrahymena thermophila. We epitope-tagged SMYD1, and analyzed its localization and interactome. We also characterized ΔSMYD1 cells, focusing on the replication and transcription phenotype. Our results show that: (1) SMYD1 is present in both cytoplasm and transcriptionally active macronucleus and shuttles between cytoplasm and macronucleus, suggesting its potential association with both histone and non-histone substrates; (2) SMYD1 is involved in DNA replication and regulates transcription of metabolism-related genes; (3) HSP90 is a potential substrate for SMYD1 and it may regulate target selection of HSP90, leading to pleiotropic effects in both the cytoplasm and the nucleus.

    HTML

Introduction
Results

    Phylogenetic analysis of SMYD family methyltransferases

  • There are five SMYD homologs (SMYD1-5) in vertebrates, such as Danio rerio, Xenopus (Silurana) tropicalis, Gallus gallus, Mus musculus, Bos taurus, Bos mutu, Pan troglodytes, Pan paniscus, and Homo sapiens. The SMYD family was divided into two main clades (Fig. 1). One branch consisted of SMYD1, 2 and 3, in which SMYD1 clustered with SMYD2 first (78% ML bootstrap support) forming a sister group to SMYD3 (89% ML). The other branch contained SMYD4 and SMYD5 (29% ML). The monophyly of SMYD1-5 was maximally supported (100% ML). This result was consistent with the domain similarity of the SMYD family (Spellmon et al. 2015): (1) SMYD1-3 shared similar domains, including the N terminal SET domain, MYND domain, and the C-terminal tetratricopeptide repeats (TPR) (Jiang et al. 2011; Sirinupong et al. 2010, 2011); (2) the domain structure of SMYD4 and SMYD5 was more divergent (Spellmon et al. 2015); SMYD4 had an extra TPR domain on its N terminus and an extended C-terminal domain, while SMYD5 lacked the C-terminal domain. The sequence differences between SMYD4 and SMYD5 partially contributed to the low branch supporting value (29% ML).

    In contrast to mammals, only one SMYD homologue is present in the genomes of many ciliates and plants (Spellmon et al. 2015). Ciliate SMYD and plant SMYD formed two well-separated clades (70% and 93% ML, respectively), indicating their diverged evolutionary paths from mammalian homologues. The clustering of ciliate SMYD also reflected the phylogenetic relationship of the constituent species which are divided between two fully supported sister branches: the oligohymenophoreans Paramecium tetraurelia and Tetrahymena thermophila and the hypotrichs Stylonychia lemnae and Oxytricha trifallax (Gao et al. 2016).

  • Localization and expression of SMYD protein in Tetrahymena thermophila

  • The expression levels of SMYD1 during the life cycle of Tetrahymena thermophila were evaluated by RT-PCR (Fig. 2a). As previously reported (Miao et al. 2009), SMYD1 is expressed during vegetative, starvation, and conjugation stages; in the present study, SMYD1 expression was highest during conjugation (Fig. 2a); however, we mainly focus on SMYD1's function at the vegetative stage. To detect its cellular localization, we initially generated a somatic SMYD1-CHA strain by introducing a short sequence encoding the hemagglutinin (HA) tag to the C-terminus of the SMYD1 gene, but we failed to detect any immunofluorescence signal, probably due to the low expression level of SMYD1 during the vegetative stage (Fig. 2a). To facilitate tracking SMYD1's distribution, an SMYD1 overexpression mutant was generated (SMYD1-CHA-overexpression) by placing SMYD1 and the C-terminal HA tag coding sequence under the cadmium-inducible MTT1 promoter (Fig. 2b). During the vegetative stage, SMYD1 was localized in both the cytoplasm and the macronucleus (Fig. 2c). As the confocal microscope scanned different layers of the Tetrahymena cell, SMYD1 showed different localization patterns: in layer 1, signals were mainly in the cytoplasm, and those in the macronucleus were weak; in layer 2, signals in the macronucleus became as strong as those in the cytoplasm; in layer 3, SMYD1 mainly appeared in the macronucleus and on the cell membrane. To remove the interference of SMYD1 signals from the cytoplasm and to reveal the presence of nuclear SMYD1, immunofluorescence staining was carried out on macronuclei purified from SMYD1-CHA-overexpression cells. Strong SMYD1 signals were detected throughout the transcriptionally active macronucleus and on the periphery of the transcriptionally inactive micronucleus (Fig. 2d), corroborating the localization of SMYD1 in the nucleus. The localization of SMYD1 in both the cytoplasm and the nucleus suggests that SMYD1 has the potential to methylate both histone and non-histone substrates (Al-Shar'i and Alnabulsi 2016; Calpena et al. 2015; Tracy et al. 2018).

    Figure 2.  Localization and expression of SMYD1 protein. a Gene expression profile for SMYD1 in wide-type cell. The different time points are shown along the X-axis. Lm stands for growing cells at the density of ~ 3.5 × 105 cells/ml. S3, S9 stands for starved cells (~ 2×105 cells/ml) collected at 3 h and 9 h after starvation, respectively. C3, C9 stands for conjugative cells (equal volumes of CU427 and CU428) collected at 3 h and 9 h after mixing, respectively. The normalized gene expression levels, as previously described (Cheng et al. 2016), are shown along the Y-axis. b Schematic diagram of SMYD1-CHA-overexpression (SMYD1-CHA-OE) plasmid. c SMYD1 signals in different layers of the same SMYD1-CHA-OE cell (vegetative stage) scanned by confocal microscopy. Arrows represent the micronucleus. Layers 1-3 indicate three different layers of the same cell. d SMYD1 signals within the nucleus obtained by nucleus purification. Arrows show the micronucleus. e pulse-labeling of SMYD1-CHA-OE (vegetative stage) cells. 0 h and 1 h stand for SMYD1 signals of cells collected at 0 h and 1 h after the removal of CdCl2, respectively. DAPI, nuclear signals; HA, signals of target protein; merge, combined signals of target protein and nucleus

    To trace the dynamic change of SMYD1 protein, we performed a pulse-chase experiment by transiently inducing the expression of SMYD1 with CdCl2 (Fig. 2e). SMYD1 was initially detected in the cytoplasm immediately after the cadmium induction (0 h), suggesting that SMYD1 was present in the cytoplasm. Signals in the cytoplasm decayed, while the macronuclear signals increased 1 h later (1 h), demonstrating that SMYD1 can shuttle between the cytoplasm and the macronucleus.

  • Phenotypic analysis of ∆SMYD1 cells

  • To reveal SMYD1's functions in Tetrahymena, we generated SMYD1 knockout cells (∆SMYD1) and characterized the phenotype. To investigate the roles of SMYD1 in regulating gene transcription, we carried out RNA-seq analysis in wild type (CU428) and the isogenic ∆SMYD1 cells. In total, 21, 461 well-annotated genes were included, among which 4841 (23%) were up-regulated (> 2-fold) and 1507 (7%) were down-regulated (< 0.5-fold). KEGG pathway analysis (Table 1) revealed that the most affected pathways in ∆SMYD1 cells were a metabolic pathway (ko01100) and biosynthesis of secondary metabolites (ko01110), supporting the assertion that SMYD1 plays important roles in regulating metabolic genes in Tetrahymena. The result of Gene Ontology (GO) term enrichment analysis (Fig. 3) was consistent with that of the KEGG pathway analysis; this revealed the single organism metabolic process as the most enriched pathway for the up-regulated genes in ∆SMYD1 cells. These results suggest that SMYD1 is involved in regulation of metabolism.

    Pathways associated with up-regulated genes
    ko01100Metabolic pathways (98)
    ko01110Biosynthesis of secondary metabolites (52)
    ko01130Biosynthesis of antibiotics (30)
    ko01120Microbial metabolism in diverse environments (25)
    ko01200Carbon metabolism (20)
    ko01230Biosynthesis of amino acids (17)
    ko00970Aminoacyl-tRNA biosynthesis (16)
    ko00230Purine metabolism (13)
    ko00010Glycolysis/gluconeogenesis (12)
    ko04141Protein processing in endoplasmic reticulum (12)
    Pathways associated with down-regulated genes
    ko03008Ribosome biogenesis in eukaryotes (17)
    ko01100Metabolic pathways (16)
    ko04142Lysosome (7)
    ko01110Biosynthesis of secondary metabolites (5)
    ko01130Biosynthesis of antibiotics (4)
    ko00270Cysteine and methionine metabolism (4)
    ko00230Purine metabolism (3)
    ko04141Protein processing in endoplasmic reticulum (3)
    ko01120Microbial metabolism in diverse environments (3)
    ko04113Meiosis-yeast (3)
    Numbers within () correspond to genes mapped onto this pathway

    Table 1.  KEGG pathway analysis for differentially expressed genes in ΔSMYD1 strain

    Figure 3.  GO (GO term: biological process) analysis of up-regulated genes in ∆SMYD1. Different biological processes are shown along the X-axis. Y-axis is the gene ratio. The higher the values, the closer the relationship between the SMYD1 protein and the target process

    To examine if there was DNA replication deficiency in ∆SMYD1 cells, immunofluorescence staining was performed for two indicative markers in the DNA damage response (DDR) system-γH2A.X (phosphorylation form of H2A.X, indicator of double strand DNA breakage) and RPA1 (single strand DNA binding protein, indicator of single strand DNA accumulation) (Gao et al. 2013). There was an increase of γH2A.X levels in ∆SMYD1 cells, similar to the phenotype of the DNA replication deficient strain ∆TXR1 (Gao et al. 2013), indicating accumulation of double strand DNA breakage produced by abnormal DNA replication (Fig. 4a). RPA1 was slightly induced at mRNA (Fig. 4b) and protein (more RPA1 foci) (Fig. 4c, white arrows) levels, weaker than ∆TXR1 cells but stronger than WT cells. Moreover, genes significantly induced in ∆TXR1 cells were mostly up-regulated (though to a more moderate degree) in ∆SMYD1 cells, including many key players in ssDNA sensing/binding, DNA alkylation repair, nucleotide excision repair (NER), mismatch repair (MMR), homologous recombination (HR), and non-homologous end joining (NHEJ) (Fig. 4b). Taken together, these results argue that SMYD1 deletion resulted in mild replication stress.

    Figure 4.  Phenotype of ∆SMYD1 cells. a Accumulation of double strand DNA breakage (DSBs) in ∆SMYD1 cells. ∆TXR1, positive control; WT, negative control, wide type; γH2A.X., indicator of double strand DNA breakage, the phosphorylation form of the histone variant H2A.X. b Heat map of relative gene expression for DNA damage response-related genes in ∆SMYD1 cells, normalized against WT cells. ∆TXR1/WT, positive control, data from (Gao et al. 2013); NER, Nucleotide excision repair; MMR, mismatch repair; HR, homologous recombination; NHEJ, non-homologous end joining. Up-regulated genes are the reddest (∆SMYD1/WT > 2) down-regulated genes are the greenest (∆SMYD1/WT < 0.5), constant genes are represented by color between them. c Accumulation of single strand DNA in ∆SMYD1 strain. White arrows show RPA1 foci, indicating the accumulation of single strand DNA in the ∆SMYD1 strain. ∆TXR1, positive control; WT, negative control, wide type; RPA1, indicator of single strand DNA, single strand DNA binding protein; DAPI, nuclear signals; merge, combined signals of the target protein and nucleus. d Growth curve of ∆SMYD1 and WT strains. X-axis, different time points; Y-axis, cell number

    It should be noted that no obvious growth defect was observed for ∆SMYD1 cells, since doubling time of ∆SMYD1 strain (Fig. 4d) showed little difference from that of WT cells (4.4 vs. 4.7 h). This suggested that SMYD1 was not essential for vegetative growth, or SMYD1 deficiency could be successfully coped with by activating the DNA damage responses (Fig. 4b).

  • Interactome of SMYD1 protein

  • To further study the mechanism underlying SMYD1 functions, immunoprecipitation (IP) of SMYD1-CHA-overexpression cells was carried out to assess the interactome of SMYD1 protein (Fig. 5a). Mass spectrometry analysis (Supplementary Table 2) revealed the heat shock protein 90 (HSP90: TTHERM_00080030) as a potential interacting partner with SMYD1, which is consistent with previous studies on mammalian systems (Donlin et al. 2012; Sima and Richter 2018; Spellmon et al. 2017). This mass spectrometry result was corroborated by the silver staining of the IP sample (Fig. 5a), which revealed a ~ 98 kDa band corresponding to the predicted size of HSP90 (blue arrow in Fig. 5a), as well as the bait protein (SMYD1) band (red arrow in Fig. 5a, ~ 53 kDa).

    Figure 5.  Interactome analysis of SMYD1 protein. a Silver staining of the SMYD1-CHA-OE IP sample. Red arrow indicates SMYD1 protein (53 kDa); blue arrow indicates the potential HSP90 protein. WT, wild type (negative control). b Purification of proteins interacting with SMYD1 using gel filtration chromatography. IP sample (without TCA precipitation) of SMYD1-CHA-OE strain was used as input. 21-32, different sized protein complex in different collection tubes: 24-25, protein complex of ~ 150 kDa; 29-32, bait protein of ~ 53 kDa (SMYD1). c Western blot of IP samples for HSP90-Nflag/SMYD1-CHA-overexpression strains with or without Cd2+ induction. SMYD1-CHA-overexpression strain with Cd2+ induction was used as negative control. d Co-localization of HSP90 and SMYD1 in Cd2+-induced HSP90-Nflag/SMYD1-CHA-overexpression strain. DAPI, nuclear signals; HSP90, HSP90 protein signals, detected by the α-Flag antibody; SMYD1, SMYD1 protein signals, detected by the α-HA antibody; Merge, combined signals of target proteins and nucleus

    To further confirm the interaction between HSP90 and SMYD1, gel filtration chromatography was used to separate proteins in the IP sample of SMYD1-CHA-overexpression cells (Fig. 5b). As a control, the bait protein band (SMYD1) was enriched in fractions 29-32 (calculated size is ~ 53 kDa). It was also enriched in fractions 24 and 25 (calculated size ~ 150 kDa), corresponding to the predicted size of the SMYD1-HSP90 complex. This result raised the possibility of direct interaction between SMYD1 and HSP90. To support this, we introduced a flag tag to the N-terminus of HSP90 in SMYD1-CHA-overexpression cells (HSP90_Nflag/SMYD1-CHA-OE) and carried out the co-precipitation of SMYD1 and HSP90 (Fig. 5c). By performing immunoprecipitation with anti-Flag M2 beads, we detected SMYD1 in the IP sample by the anti-HA antibody at the expected size (~ 53 kDa) (Fig. 5c lane 2). As negative controls, no SMYD1 band was detected without cadmium induction (Fig. 5c, lanes 3 and 4) or in IP samples from cells without flag-tagged HSP90 (Fig. 5c, lanes 5 and 6). These results support the interaction between SMYD1 and HSP90.

    To investigate whether SMYD1 can methylate HSP90, SMYD1 in vitro methyltransferase assay was performed. We only detected a ~ 53 kDa radioactive band (Supplementary Fig. 1, red arrow), representing either the self-methylated SMYD1 or SMYD1 binding of H3-labeled S-adenosylmethionine (SAM). Though we failed to detect any radioactive band of HSP90, the ~ 53 kDa radioactive band provides evidence that SMYD1 protein possesses the methyltransferase activity.

Discussion

    SMYD homologues in ciliates

  • The phylogenetic position of ciliate SMYD1 was revealed in this study for the first time, on the basis of phylogenetic analysis in metazoans (Calpena et al. 2015; Jiang et al. 2017). Ciliate SMYD1 occupied a basal position in the phylogenetic tree, which is consistent with the early branching position of ciliates in the evolutionary history of eukaryotes (Adl et al. 2012; Sheng et al. 2018; Zhang et al. 2018; Zhao et al. 2018; Zheng et al. 2018), The presence of a single homologue is likely an ancestral state, given that only one homologue was identified in ciliates, while several occur in animals.

    Interestingly, SMYD homologues of the four ciliates included in this study showed relatively low similarity (in the range of 10.4%-41%). This high diversity of ciliate SMYD is consistent with the fact that ciliates underwent radiation after their early branching and harbored a rich pool of morphological and genetic diversities (Chen et al. 2014, 2018, 2019; Guerin et al. 2017; Hamilton et al. 2016; Huang et al. 2018; Luo et al. 2018; Noto and Mochizuki 2017; Wang et al. 2019; Xu et al. 2019a, b; Yan et al. 2018).

  • SMYD is involved in the regulation of metabolism-related genes and DNA replication

  • SMYD proteins in mammals are located in both the cytoplasm and the nucleus, and correspondingly have the ability to methylate both histone and non-histone targets (Brown et al. 2006; Gottlieb et al. 2002; Hamamoto et al. 2004; Huang et al. 2006; Mazur et al. 2014; Tracy et al. 2018; Yi et al. 2017). SMYD1 was also detected in both the cytoplasm and the macronucleus (and possibly micronucleus) in Tetrahymena cells, which is consistent with its localization in mammalian systems.

    The SMYD1 localization in the transcriptionally active macronucleus is consistent with its potential role in regulating gene expression. Extensive studies have pointed out that mammalian SMYD proteins can affect gene accessibility by histone methylation and interaction with transcription factors (Abu-Farha et al. 2008; Chen et al. 2017; Gottlieb et al. 2002). In the current study, we revealed that ciliate SMYD1 is involved in the regulation of metabolism-related genes and consequently plays roles in Tetrahymena metabolism. Therefore, we proposed that functions of mammalian SMYD in cancer development (Giakountis et al. 2017; Hu et al. 2009; Leinhart and Brown 2011; Mazur et al. 2016) might have evolved from the function of SMYD1 in regulating metabolism-related genes in ciliates. However, the underlying mechanism in ciliates is yet to be explored.

    The regulation of DNA replication by SMYD has not been reported before. In this study, we demonstrate that lack of SMYD1 in Tetrahymena causes mild DNA replication stress, manifested by the accumulation of DNA double strand breaks (DSBs) and single strand DNA (ssDNA), and activation of DNA damage response.

  • HSP90 is a conserved SMYD substrate

  • HSP90 is an essential chaperone protein involved in a variety of biological processes, including stabilizing proteins against heat stress, stabilizing a quantity of tumor proteins, and enhancing the loading process of small RNAs into Argonaute proteins (Bachman et al. 2018; Karras et al. 2017; Taipale et al. 2010; Woehrer et al. 2015). In mammalian cells, SMYD2 was shown to regulate biological functions of HSP90 by methylating its different domains (Abu-Farha et al. 2011). Our data show that Tetrahymena SMYD1 and HSP90 are both localized in the cytoplasm. More importantly, Tetrahymena SMYD1 can physically interact with HSP90 and may have the capability to catalyze methylation. Thus, we propose that HSP90 is one of the conserved substrates for SMYD methyltransferases. More studies are needed to explore the functions of SMYD in regulating HSP90.

    In conclusion, our study represents the first report of the functions of methyltransferase SMYD in the single-cell model organism Tetrahymena thermophila. We revealed the localization and dynamics of SMYD1 in Tetrahymena cytoplasm and nucleus, and demonstrated the roles of Tetrahymena SMYD1 in DNA replication and transcription regulation. Additionally, we show that accumulating evidence supports the possibility that HSP90 is a conserved SMYD substrate. These findings support a conserved function in ciliate SMYD and shed light on the mechanisms that underlie the roles that SMYD family proteins play in the development of cancer in higher eukaryotes.

Materials and methods

    Phylogenetic analysis of SMYD

  • A total of 47 SMYD amino acid sequences (Table 2) of representative eukaryotic species were downloaded from the National Center for Biotechnology Information (NCBI) Database (https://www.ncbi.nlm.nih.gov/). Sequences were aligned by MUSCLE 3.7 (Edgar 2004), provided on the web server "Phylogeny.fr Robust Phylogenetic Analysis For The Non-Specialist" (http://phylogeny.lirmm.fr/phylo_cgi/one_task.cgi?task_type=muscle). The alignment was used for the subsequent phylogenetic tree construction.

    Species name and protein nameGenBank accession no.Species name and protein nameGenBank accession no.
    Danio rerio SMYD1NP_001034725Gallus gallus SMYD4NP_001025886
    Xenopus (Silurana) tropicalis SMYD1XP_012811600Mus musculus SMYD4AAH95952
    Gallus gallus SMYD1NP_989486Bos taurus SMYD4XP_005220153
    Mus musculus SMYD1NP_001153599Pan paniscus SMYD4XP_003816904
    Bos taurus SMYD1DAA24603Homo sapiens SMYD4NP_443160
    Pan paniscus SMYD1XP_003805903Drosophila virilis SMYD5XP_002053397
    Homo sapiens SMYD1NP_938015Branchiostoma floridae SMYD5XP_002609030
    Danio rerio SMYD2NP_001013568Xenopus laevis SMYD5NP_001085635
    Xenopus (Silurana) tropicalis SMYD2XP_00293475NP_9380151Danio rerio SMYD5NP_001004614
    Gallus gallus SMYD2NP_001264500Gallus gallus SMYD5NP_001012912
    Mus musculus SMYD2EDL13024Bos taurus SMYD5NP_001073717
    Bos mutus SMYD2NP_001069832Mus musculus SMYD5NP_659167
    Pan troglodytes SMYD2XP_003308794Pan paniscus SMYD5XP_003808242
    Homo sapiens SMYD2NP_064582Homo sapiens SMYD5NP_006053
    Danio rerio SMYD3NP_001032477Stylonychia lemnaeCDW88943
    Xenopus (Silurana) tropicalis SMYD3XP_004914684Oxytricha trifallaxEJY75465
    Gallus gallus SMYD3XP_015139481Paramecium tetraureliaXP_001437474
    Bos mutus SMYD3XP_005216902Tetrahymena thermophilaXP_001022867
    Mus musculus SMYD3NP_081464Volvox carteri f. nagariensisXP_002956692
    Pan paniscus SMYD3XP_514316Physcomitrella patensXP_001778213
    Homo sapiens SMYD3NP_001161212Oryza sativaAAS07242
    Branchiostoma floridae SMYD4XP_002589088Arabidopsis lyrata subsp. lyrataXP_002886136

    Table 2.  Accession numbers of species used in the phylogenetic tree

    A Maximum-Likelihood (ML) tree was constructed with RAxML-HPC2 on XSEDE v 7.2.8 (Stamatakis 2006; Stamatakis et al. 2008), provided by the CIPRES Science Gateway (Miller et al. 2010), using plant species, Volvox carteri f. nagariensis, Physcomitrella patens, Oryza sativa, Arabidopsis lyrata subsp. lyrata and Glycine max, as the outgroup. The MTART model of Protein Substitution Matrix selected by ProtTest 3 (Darriba et al. 2011) and other defaulted parameters were used for the maximum-likelihood (ML) analysis. The robustness of internal branches was estimated by 1000 bootstrap replicates.

  • Strains and culture conditions

  • The wide-type Tetrahymena thermophila strain CU428 (provided by Tetrahymena Stock Center, Cornell University, Ithaca, NY), from which all mutant strains were derived, was cultured in SPP medium (Orias et al. 1999) at 30 ℃. Cells in mid-exponential growth phase (~ 2×105 cells/ml) were used for subsequent experiments.

  • Generation of the transgenic strains

  • In the current study, 6 constructs, including ∆SMYD1, SMYD1-CHA, ∆SMYD1-RPA1-CHA, SMYD1-CHA-overexpression, and HSP90-Nflag were generated, and all primers used here are listed in Table 3. Construct RPA1-CHA was generated as previously described (Gao et al. 2013). Constructs ∆SMYD1 and SMYD1-CHA were generated according to previous studies (Feng et al. 2017; Liu et al. 2007; Noto et al. 2015). For the SMYD1-CHA-overexpression construct, the target fragments were cloned into the newly constructed CHA-overexpression vectors. CHA-overexpression vectors were generated based on the inducible MTT1 and MTT3 promotors (Cd2+ inducible) to investigate proteins of low expression level. Primers used are shown in Supplementary Table 1. The MTT1-MTT3 region, including the 3′ and 5′ untranslated regions (5.4 kb in total), were amplified with Platinum Tag DNA Polymerase (Invitrogen, 11304-011) and cloned into pBlueScript SK (-) vector. The MTT3 locus was replaced with neo4 coding region, providing the paromomycin resistance for cells. The MTT1 locus was replaced by Flag-HA tag with Sbf I cutting site on its N terminus.

    NameSequence
    SMYD1_5f715_NotIAGTTCTAGAGCGGCCGCGATTATTCGCCTATAGTTGATGG
    SMYD1_3r5096_Not IACCGCGGTGGCGGCCGCGTTTCCTACTCAGTCTCTTGC
    SMYD1_Nf1849_GHACCCTACGACGTCCCCGACTACGCCTACTAGGTAGAAAATCTTAATAATTAGTATCG
    SMYD1_Nr1848_GHAGTCGGGGACGTCGTAGGGGTATCCCATATATATCTTTGATTTTCTAAATTAATTG
    SMYD1_Cf3335_GHACCCTACGACGTCCCCGACTACGCCTGATATTCTTTAAAATAAAATAAAAAAAAG
    SMYD1_Cr3334_GHAGTCGGGGACGTCGTAGGGGTATCCATTATATTTCATTTTTATCTCAC
    SMYD1_3f3956_neo4CTGACGTCGCACCATCCCGTTGTTGCATAGGATTGTTTTCG
    SMYD1_3r3928_neo4GTCAGGTGCCTGGTACCCGTTTATTTAAAAAGCAGTAGC
    SMYD1_f2734CTTTTTGTGTGAATGTAAAAGGTG
    SMYD1_r2862CCTTAAGTGTTACAGTCAGAGC
    α-Tubulin_fTCAGTAACCTTCTTCTTCACC
    α-Tubulin_rCACTGGTTTCAAGGTCGGTAT
    MTT1_SMYD1_f1724_NHACGTCCCCGACTACGCCTACTAGGTAGAAAATCTTAATAATTAG
    MTT1_SMYD1_r3241_NHACATATTTATTTCACCTATTATATTTCATTTTTATCTCACTTTTTATATC
    MTT1_SMYD1_f1698_CHACTTAAAATAATGGATCCTTACTAGGTAGAAAATCTTAATAATTAG
    MTT1_SMYD1_r3217_CHACGTCGTAGGGGTATCCATTATATTTCATTTTTATCTCACTTTTTATATC
    HSP90_5f1223_Not IAGTTCTAGAGCGGCCGCATCAAAGTATGAAGAAGACAGG
    HSP90_3r6007_Not IACCGCGGTGGCGGCCGCTAATCAAATAAATCTCTCTGTTCTG
    HSP90_Nf2158_FlagGGAGACTACAAGGACGACGATGACAAGTCTCAACAAGCTGAACACTTTGC
    HSP90_Nr2157_FlagGTCATCGTCGTCCTTGTAGTCTCCCATTTCTTATGATATATCTTTTTTTTTAAT
    HSP90_3f5043_BSRCTGACGTCGCACCATCCCGTGAAGTTTTTTGATATTATCACAC
    HSP90_3r5004_BSRGTCAGGTGCCTGGTACCCACTTTTATATCAGTGAAAATGGAG
    Italic characters represent the adaptors

    Table 3.  Primers used for plasmid construction and RT-PCR

    All of the above constructs except RPA1-CHA and HSP90-Nflag were introduced into CU428 by standard biolistic transformations (Cassidy-Hanley et al. 1997). RPA1-CHA was introduced into ∆SMYD1 strain, and HSP90-Nflag into SMYD1-CHA-overexpression strain, respectively. Paromomycin, Cycloheximide or Blasticidin was used for subsequent transformant selection according to the drug cassette. Complete somatic replacement was validated by quantitative-PCR as previously reported (Zhao et al. 2017).

  • Macronucleus purification

  • SMYD1-CHA-overexpression stain was cultured overnight (~ 18 h) in 1L 1 × SPP containing 0.5 μg/ml CdCl2. Mid-log-phase (~ 2×105 cells/ml) cells were collected and the macronucleus purification was carried out as described (Chen et al. 2016). The purified macronuclei were washed with nuclear wash buffer (50 mmol/L pH 7.4 Tris, 2 mmol/L MgCl2) once and resuspended in 200 μl nuclear wash buffer for subsequent immunofluorescence staining.

  • Immunofluorescence staining

  • A volume of 15 ml of target cells in mid-exponential growth phase was collected and fixed in 2% paraformaldehyde (diluted with 1 × PBS). Permeabilization was then accomplished with 0.4% Triton X-100 (diluted with 1 × PBS), after which antibodies (details in Table 4) were incubated with cells (Gao et al. 2013; Liu et al. 2007). Digital images were captured using an Olympus BX43 microscope and an Olympus DP73 camera.

    AntibodydilutionIncubation condition
    Primary antibodyα-HA (Rabbit monoclonal, Cell Signaling, 3724S)1:20004 ℃, overnight
    α-γH2A.X(Mouse monoclonal, Millipore, 05636)1:5000RT, 2 h
    α-Flag (Mouse monoclonal, Sigma, F1804)1:50004 ℃, overnight
    Secondary antibodyGoat Anti Mouse 555 IgG (Invitrogen, A32727)1:5000RT, 1 h
    Goat Anti Rabbit 555 IgG (Invitrogen, A27017)1:5000RT, 1 h
    Goat Anti Rabbit 488 IgG (Invitrogen, A32731)1:5000RT, 1 h

    Table 4.  Antibodies for immunofluorescence staining

  • Immunoprecipitation and quantitative liquid chromatography-mass spectrometry (LC-MC) analysis

  • SMYD1-CHA-overexpression cells were cultured overnight in 800 ml 1 × SPP containing 0.5 μg/ml CdCl2. Cells at mid-log phase were collected by centrifugation and immunoprecipitation (IP, details shown in Supplementary Methods) was carried out, after which the IP sample was sent to Proteomics Resource Facility (Department of Pathology, University of Michigan) for LC-MC analysis.

    The HSP90-Nflag/SMYD1-CHA-overexpression strain was cultured overnight in 800 ml 1 × SPP with or without 0.5 μg/ml CdCl2. At the same time, the SMYD1-CHA-overexpression strain was cultured overnight in 800 ml 1 × SPP as a negative control. IP was carried out on these strains as described above. IP samples were used for western blotting with primary antibodies α-Flag (Mouse monoclonal, Sigma, F1804, 1:5000) and α-HA (Rabbit monoclonal, Cell Signaling, 3724S, 1:2000).

  • In vitro methyltransferase assay

  • An IP sample (without TCA precipitation) of SMYD1-CHA-overexpression strain was used for the in vitro methyltransferase activity test. Immunoprecipitation was modified from the protocol outlined in the Supplementary Methods, in which T0 buffer (30 mmol/L Tris HCl, 30 mmol/L Tris Base, 20 mmol/L KCl and 2 mmol/L MgCl2) was used instead of T150 buffer (30 mmol/L Tris HCl, 30 mmol/L Tris Base, 20 mmol/L KCl, 2 mmol/L MgCl2 and 150 mmol/L NaCl) and HA elution (eluted with 250 μg/ml HA peptide at RT for 15 min) was used as a final product for the subsequent methyltransferase activity test.

    The in vitro methyltransferase activity test was modified from previous studies (Wu et al. 2013; Zhou et al. 2016). For each test, H3-labeled S-adenosylmethionine (SAM, final concentration 10 mmol/L, from Perkin Elmer, NET155H250UC) was added to 20 μl IP sample (without TCA precipitation, in T0 buffer) or 20 μl T0 buffer (negative control). The reaction was carried out at 25 ℃ overnight, after which the methylation was detected by autoradiography.

  • Total RNA extraction and RT-PCR

  • A volume of 10 ml of cells was collected at indicated time points. TRIzol™ Reagent (Invitrogen, 15596026) was used to extract the total RNA, after which DNA was removed with the Turbo DNA-free kit (Ambion, AM 1907). Complementary DNA (cDNA) was reverse-transcribed using Superscript Ⅲ Reverse Transcriptase kit (Invitrogen, 18080-051) with parameters as follows: 50 ℃ for 50 min, 85 ℃ for 5 min, and maintained at 4 ℃.

    RT-PCR, with cDNA as template, was carried out on a CFX96™ Real-Time System (BIO-RAD, USA) with the Radiant™ Green Lo-Rox qPCR Kit (Alkali Scientific, QS1020). The reaction was carried out as previously described (Gao et al. 2013). Each reaction was performed in duplicate using primers SMYD1_f2734 and SMYD1_r2862 (Table 3). α-Tubulin_f and α-Tubulin_r (Table 3) were used as internal controls (Cheng et al. 2016). The 2-ΔΔCt method was used to analyze the real-time PCR data.

  • RNA extraction, library preparation, Illumina sequencing and data analysis

  • Total RNA of log-phase ∆SMYD1 and wild-type CU428 cells (negative control) were extracted using Qiashredder (Qiagen, 79654) and RNeasy Kit (Qiagen, 74624) according to the protocol provided in TetraFGD (Xiong et al. 2013). The Qubit RNA Assay Kit in Qubit 2.0 Flurometer (Life Technologies, CA, USA, Q32852) and the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA, 5067-1511) were used to measure the RNA concentration and integrity, respectively.

    In total, 3 μg RNA was used for sample preparation. The sequencing library was produced by NEBNext Ultra RNA Library Prep Kit for Illumina (New England Biolabs, MA, USA, E7530L) according to manufacturer's recommendations, and details are as previously described (Zhang et al. 2015). The library was sequenced on the Illumina Hiseq 2500 platform provided by Novogene Bioinformatics Institute (Beijing, China), and 125 bp paired-end reads were generated.

    FASTX-Toolkit (Gordon and Hannon 2010) was used to remove adapters and reads of low quality from the raw data, after which the remaining reads were mapped onto the Tetrahymena thermophila genome (http://ciliate.org/index.php/home/downloads, June 2014). Gene expression levels were calculated by RSEM v1.2.7 (Li and Dewey 2011). A heat map of genes differentially expressed between ∆SMYD1 and CU428 was generated with MultiExperiment Viewer (v4.9) (Mar et al. 2011). The KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis was carried out using the KAAS server (http://www.genome.jp/kegg/kaas/). Gene Ontology (GO) term enrichment analysis on the up-regulated genes was performed using BiNGO v3.0.3 (p.adjust < 0.05), which was integrated in Cytoscape v3.4.0, and the plot was generated by the R package, ggplot2 (Kohl et al. 2011; Maere et al. 2005; Wickham 2016).

  • Gel filtration chromatography

  • The IP sample (without TCA precipitation) of the SMYD1-CHA-overexpression strain was used as input of the purification. Purification was carried out by the AKTApurifier HPLC system (including Pump P-900 and Superose 6 column, GE Healthcare) according to previous studies (Hubert et al. 2014; Hughes et al. 2013). Firstly, filtered distilled water was pumped into the system to remove any contamination and bubbles, after which filtered T0 buffer was pumped into the system as loading buffer. Secondly, formula between the Retention Volume and Molecular Weight was calculated using two marker proteins, BSA (66 kDa) and WDR5 (36 kDa); that is Rv = (2.9661-logMw)/0.073, where Rv is Retention Volume (ml) and Mw is Molecular Weight (kDa). Thirdly, 300 μl IP samples of the SMYD1-CHA-overexpression strain were added into the system by 1 ml syringe and run at a flow rate of 0.5 ml/min to purify proteins of different sizes. Samples (10 μl) from each fraction (500 μl/tube) were retained for western blot analysis.

  • Pulse-chase experiment

  • The SMYD1-CHA-overexpression strain was cultured in 60 ml 1 × SPP at 30 ℃ overnight. The mid-log-phase cells were pulse-labeled by adding CdCl2 (final concentration 1.5 μg/ml) into the medium. Two hours later, CdCl2 was removed by washing with 1 × SPP twice. Cells were resuspended in 60 ml fresh 1 × SPP and collected at 1 h intervals during the chase.

Acknowledgements
  • This work was supported by the Natural Science Foundation of Shandong Province (JQ201706 to SG), Fundamental Research Funds for the Central Universities (201841013 to SG), National Science Foundation [MCB 1411565 to YL], and National Institutes of Health Foundation [R01 GM087343 to YL]. XZ was supported by China Scholarship Council Scholarship for joint PhD students. Our thanks are given to Ms. Yuanyuan Wang (Laboratory of Protozoology, Ocean University of China), for helping with the preparation of Fig. 1.

Author contributions
  • SG, YFL and XLZ participated in study design. XLZ carried out most of the experiments. YL conducted the establishment of HSP90-Nfag/SMYD1-CHA-overexpression strain and LLD prepared the RNA-seq samples. XC and FBM conducted the bioinformatics analysis. Manuscript writing was conducted by XLZ with assistance from SG, YFL, WBS and MJ. All authors have read and approved the fnal manuscript.

Data availability
  • RNA-seq datasets have been deposited to NCBI with accession number GEO: GSE138246.

Compliance with ethical standards
  • Conflict of interest The authors declare that they have no confict of interest.

    Animal and human rights statement This article does not contain any studies with human participants or animals performed by any of the authors

Reference (114)

Catalog

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return