+Advanced Search
Volume 2 Issue 1
Feb.  2020
Article Contents

Citation:

Effects of Bacillus subtilis on hepatic lipid metabolism and oxidative stress response in grass carp (Ctenopharyngodon idellus) fed a high-fat diet

  • Edited by Xin Yu.
  • Bacillus subtilis is widely used in aquaculture as a probiotic. However, few studies have been conducted to examine the efect of B. subtilis on liver lipid metabolism. A total of 135 healthy grass carp (50.24 ± 1.38 g) were randomly divided into three groups: control (Con), high-fat diet (HF), and high-fat diet + B. subtilis (HF + B. subtilis), and fed for 8 weeks. The results showed that compared with the HF group, the weight gain rate (WGR) signifcantly increased (P < 0.05) and the hepatic lipid content, serum low-density lipoprotein cholesterol (LDL-C), and aspartate aminotransferase (AST) decreased in the group supplemented with B. subtilis (P < 0.05). Moreover, the hepatic mRNA expression of fatty acid synthase (FAS) was signifcantly down-regulated and the carnitine palmitoyl transferases (CPT1α1a) were up-regulated in the HF + B. subtilis group compared to the HF group (P < 0.05), respectively. Additionally, in the HF + B. subtilis group, glutathione (GSH) signifcantly increased (P < 0.05), while hydrogen peroxide (H2O2) and malondialdehyde (MDA) contents signifcantly decreased compared to the HF group (P < 0.05). B. subtilis may reduce the hepatic lipid content by inhibiting its synthesis and promoting β-oxidation of fatty acids. B. subtilis may also alleviate dyslipidaemia and prevent oxidative damage in the liver caused by the high-fat diet of grass carp. Hence, dietary supplementation with B. subtilis shows promise as a therapeutic or preventive tool against fatty liver disease.
  • 加载中
  • Abass DA, Obirikorang KA, Campion BB, Edziyie RE, Skov PV (2018) Dietary supplementation of yeast (Saccharomyces cerevisiae) improves growth, stress tolerance, and disease resistance in juvenile Nile tilapia (Oreochromis niloticus). Aquac Int 26:843–855 doi: 10.1007/s10499-018-0255-1
    Al-Muzafar HM, Amin KA (2017) Probiotic mixture improves fatty liver disease by virtue of its action on lipid profles, leptin, and infammatory biomarkers. BMC Complement Altern Med 17:43 doi: 10.1186/s12906-016-1540-z
    An HM, Park SY, Lee DK, Kim JR, Cha MK, Lee SW, Lim HT, Kim KJ, Ha NJ (2011) Antiobesity and lipid-lowering efects of Bifdobacterium spp. in high fat diet-induced obese rats. Lipids Health Dis 10:116 doi: 10.1186/1476-511X-10-116
    Awaisheh SS, Khalifeh MS, Al-Ruwaili MA, Khalil OM, Al-Ameri OH, Al-Groom R (2013) Efect of supplementation of probiotics and phytosterols alone or in combination on serum and hepatic lipid profles and thyroid hormones of hypercholesterolemic rats. J Dairy Sci 96:9–15 doi: 10.3168/jds.2012-5442
    Banda IGDL, Lobo C, León-Rubio JM, Tapia-Paniagua S, Balebona MC, Moriñigo MA, Moreno-Ventas X, Lucas LM, Linares F, Arce F (2010) Infuence of two closely related probiotics on juvenile Senegalese sole (Solea senegalensis, Kaup 1858) performance and protection against Photobacterium damselae subsp. piscicida. Aquaculture 306:281–288 doi: 10.1016/j.aquaculture.2010.05.008
    Briskey D (2015) The efects of multi-strain probiotics on liver disease. PhD thesis, The University of Queensland
    Chatzifotis S, Panagiotidou M, Papaioannou N, Pavlidis M, Nengas I, Mylonas CC (2010) Efect of dietary lipid levels on growth, feed utilization, body composition and serum metabolites of meagre (Argyrosomus regius) juveniles. Aquaculture 307:65–70 doi: 10.1016/j.aquaculture.2010.07.002
    Chelladurai G, Veni T, Mohanraj J, Vijayakumar I (2012) The investigation of Lactobacillus acidophillus as probiotics on growth performance and gut microfora of cat fsh (Mystus Montanus). Int J Res Fish Aquac 2:41–43
    Chen QL, Luo Z, Pan YX, Zheng JL, Zhu QL, Sun LD, Zhuo MQ, Hu W (2013) Diferential induction of enzymes and genes involved in lipid metabolism in liver and visceral adipose tissue of juvenile yellow catfsh Pelteobagrus fulvidraco exposed to copper. Aquat Toxicol 136–137:72–78
    Chen QQ, Liu WB, Zhou M, Dai YJ, Xu C, Tian HY, Xu WN (2016) Efects of berberine on the growth and immune performance in response to ammonia stress and high-fat dietary in blunt snout bream Megalobrama amblycephala. Fish Shellfsh Immunol 55:165–172 doi: 10.1016/j.fsi.2016.05.023
    Du Z, Liu Y, Tian L, Wang J, Wang Y, Liang G (2005) Efect of dietary lipid level on growth, feed utilization and body composition by juvenile grass carp (Ctenopharyngodon idella). Aquac Nutr 11:139–146 doi: 10.1111/j.1365-2095.2004.00333.x
    Du ZY, Clouet P, Zheng WH, Degrace P, Tian LX, Liu YJ (2006) Biochemical hepatic alterations and body lipid composition in the herbivorous grass carp (Ctenopharyngodon idella) fed highfat diets. Br J Nutr 95:905–915 doi: 10.1079/BJN20061733
    Eberle D, Hegarty B, Bossard P, Ferre P, Foufelle F (2004) SREBP transcription factors: master regulators of lipid homeostasis. Biochimie 86:839–848 doi: 10.1016/j.biochi.2004.09.018
    Falcinelli S, Picchietti S, Rodiles A, Cossignani L, Merrifeld DL, Taddei AR, Maradonna F, Olivotto I, Gioacchini G, Carnevali O (2015) Lactobacillus rhamnosus lowers zebrafsh lipid content by changing gut microbiota and host transcription of genes involved in lipid metabolism. Sci Rep 5:9336 doi: 10.1038/srep09336
    Falcinelli S, Rodiles A, Hatef A, Picchietti S, Cossignani L, Merrifeld DL, Unniappan S, Carnevali O (2017) Dietary lipid content reorganizes gut microbiota and probiotic L. rhamnosus attenuates obesity and enhances catabolic hormonal milieu in zebrafsh. Sci Rep 7:5512 doi: 10.1038/s41598-017-05147-w
    Hassaan MS, Soltan MA, Jarmołowicz S, Abdo HS (2018) Combined efects of dietary malic acid and Bacillus subtilis on growth, gut microbiota and blood parameters of Nile tilapia (Oreochromis niloticus). Aquac Nutr 24:83–93 doi: 10.1111/anu.12536
    Hillestad M, Johnsen F, Austreng E, Åsgård T (1998) Long-term efects of dietary fat level and feeding rate on growth, feed utilization and carcass quality of Atlantic salmon. Aquac Nutr 4(2):89–97 doi: 10.1046/j.1365-2095.1998.00051.x
    Huang C, Zhang Z, Wu S, Zhang D, Li S, Chen X, Wu Z (2017) The protective efect of probiotic Bacillus subtilis on the intestinal mucosal structure of Ctenopharyngodon idellus. Acta Hydrobiol Sin 41:774–780
    Huang L, Cheng Y, Huang K, Zhou Y, Ma Y, Zhang M (2018) Ameliorative efect of Sedum sarmentosum Bunge extract on Tilapia fatty liver via the PPAR and P53 signaling pathway. Sci Rep 8:8456 doi: 10.1038/s41598-018-26084-2
    Ji H, Li J, Liu P (2011) Regulation of growth performance and lipid metabolism by dietary n-3 highly unsaturated fatty acids in juvenile grass carp, Ctenopharyngodon idellus. Comp Biochem Physiol B 159:49–56 doi: 10.1016/j.cbpb.2011.01.009
    Jung CH, Cho I, Ahn J, Jeon TI, Ha TY (2013) Quercetin reduces highfat diet-induced fat accumulation in the liver by regulating lipid metabolism genes. Phytother Res 27:139–143 doi: 10.1002/ptr.4687
    Kerner J, Hoppel C (2000) Fatty acid import into mitochondria. Biochim Biophys Acta 1486:1–17 doi: 10.1016/S1388-1981(00)00044-5
    Kong W, Huang C, Tang Y, Zhang D, Wu Z, Chen X (2017a) Efect of Bacillus subtilis on Aeromonas hydrophila-induced intestinal mucosal barrier function damage and infammation in grass carp (Ctenopharyngodon idella). Sci Rep 7:1588 doi: 10.1038/s41598-017-01336-9
    Kong WG, Li SS, Chen XX, Huang YQ, Tang Y, Wu ZX (2017b) A study of the damage of the intestinal mucosa barrier structure and function of Ctenopharyngodon idella with Aeromonas hydrophila. Fish Physiol Biochem 43:1223–1235 doi: 10.1007/s10695-017-0366-z
    Lee HY, Park JH, Seok SH, Baek MW, Kim DJ, Lee KE, Paek KS, Lee Y, Park JH (2006) Human originated bacteria, Lactobacillus rhamnosus PL60, produce conjugated linoleic acid and show anti-obesity efects in diet-induced obese mice. Biochim Biophys Acta 1761:736–744 doi: 10.1016/j.bbalip.2006.05.007
    Li W, Zhang X, Song W, Deng B, Zheng J, Liang Q, Wang Y, Fu L, Yu D (2012) Efects of Bacillus preparations on immunity and antioxidant activities in grass carp (Ctenopharyngodon idellus). Fish Physiol Biochem 38:1585–1592 doi: 10.1007/s10695-012-9652-y
    Li A, Yuan X, Liang XF, Liu L, Li J, Li B, Fang J, Li J, He S, Xue M, Wang J, Tao Y-X (2016) Adaptations of lipid metabolism and food intake in response to low and high fat diets in juvenile grass carp (Ctenopharyngodon idellus). Aquaculture 457:43–49 doi: 10.1016/j.aquaculture.2016.01.014
    Ma X, Hua J, Li Z (2008) Probiotics improve high fat diet-induced hepatic steatosis and insulin resistance by increasing hepatic NKT cells. J Hepatol 49:821–830 doi: 10.1016/j.jhep.2008.05.025
    Ma Q, Li LY, Le JY, Lu DL, Qiao F, Zhang ML, Du ZY, Li DL (2018) Dietary microencapsulated oil improves immune function and intestinal health in Nile tilapia fed with high-fat diet. Aquaculture 496:19–29 doi: 10.1016/j.aquaculture.2018.06.080
    Morash AJ, Kajimura M, McClelland GB (2008) Intertissue regulation of carnitine palmitoyltransferase I (CPTI): mitochondrial membrane properties and gene expression in rainbow trout (Oncorhynchus mykiss). Biochim Biophys Acta 1778:1382–1389 doi: 10.1016/j.bbamem.2008.02.013
    Munirasu S, Ramasubramanian V, Arunkumar P (2017) Efect of Probiotics diet on growth and biochemical performance of freshwater fsh Labeo rohita fngerlings. J Entomol Zool Stud 5:1374–1379
    Ozer J, Ratner M, Shaw M, Bailey W, Schomaker S (2008) The current state of serum biomarkers of hepatotoxicity. Toxicology 245:194–205 doi: 10.1016/j.tox.2007.11.021
    Ren Y, Li S, Wu Z, Zhou C, Zhang D, Chen X (2017) The infuences of Bacillus subtilis on the virulence of Aeromonas hydrophila and expression of luxs gene of both bacteria under co-cultivation. Curr Microbiol 74:718–724 doi: 10.1007/s00284-017-1236-8
    Rincon-Cervera MA, Valenzuela R, Hernandez-Rodas MC, Marambio M, Espinosa A, Mayer S, Romero N, Barrera MSC, Valenzuela A, Videla LA (2016) Supplementation with antioxidant-rich extra virgin olive oil prevents hepatic oxidative stress and reduction of desaturation capacity in mice fed a high-fat diet: efects on fatty acid composition in liver and extrahepatic tissues. Nutrition 32:1254–1267 doi: 10.1016/j.nut.2016.04.006
    Roberto G, Giovanni M, Maurizio C (2011) Redox balance in the pathogenesis of nonalcoholic fatty liver disease: mechanisms and therapeutic opportunities. Antioxid Redox Signal 15:1325–1365 doi: 10.1089/ars.2009.3058
    Rosen ED, Sarraf P, Troy AE, Bradwin G, Moore K, Milstone DS, Spiegelman BM, Mortensen RM (1999) PPAR gamma is required for the diferentiation of adipose tissue in vivo and in vitro. Mol Cell 4:611–617 doi: 10.1016/S1097-2765(00)80211-7
    Sabzi E, Mohammadiazarm H, Salati AP (2017) Efect of dietary l -carnitine and lipid levels on growth performance, blood biochemical parameters and antioxidant status in juvenile common carp (Cyprinus carpio). Aquaculture 480:89–93 doi: 10.1016/j.aquaculture.2017.08.013
    Schroeder F, Jolly CA, Cho TH, Frolov A (1998) Fatty acid binding protein isoforms: structure and function. Chem Phys Lipids 92:1–25 doi: 10.1016/S0009-3084(98)00003-6
    Shen WY, Fu LL, Li WF, Zhu YR (2010) Efect of dietary supplementation with Bacillus subtilis on the growth, performance, immune response and antioxidant activities of the shrimp (Litopenaeus vannamei). Aquac Res 41:1691–1698 doi: 10.1111/j.1365-2109.2010.02554.x
    Shimada Y, Kuninaga S, Ariyoshi M, Zhang B, Shiina Y, Takahashi Y, Umemoto N, Nishimura Y, Enari H, Tanaka T (2015) E2F8 promotes hepatic steatosis through FABP3 expression in dietinduced obesity in zebrafsh. Nutr Metab 12:17 doi: 10.1186/s12986-015-0012-7
    Song YF, Luo Z, Zhang LH, Hogstrand C, Pan YX (2016) Endoplasmic reticulum stress and disturbed calcium homeostasis are involved in copper-induced alteration in hepatic lipid metabolism in yellow catfsh Pelteobagrus fulvidraco. Chemosphere 144:2443–2453 doi: 10.1016/j.chemosphere.2015.11.031
    Standen BT, Peggs DL, Rawling MD, Foey A, Davies SJ, Santos GA, Merrifeld DL (2016) Dietary administration of a commercial mixed-species probiotic improves growth performance and modulates the intestinal immunity of tilapia, Oreochromis niloticus. Fish Shellfsh Immunol 49:427–435 doi: 10.1016/j.fsi.2015.11.037
    Tang Y, Han L, Chen X, Xie M, Kong W, Wu Z (2018) Dietary supplementation of probiotic Bacillus subtilis afects antioxidant defenses and immune response in grass carp under Aeromonas hydrophila Challenge. Probiotics Antimicro. https://doi.org/10.1007/s12602-018-9409-8
    Tapia-Paniagua ST, Díaz-Rosales P, García de la Banda I, Lobo C, Clavijo E, Balebona MC, Moriñigo MA (2014) Modulation of certain liver fatty acids in Solea senegalensis is infuenced by the dietary administration of probiotic microorganisms. Aquaculture 424–425:234–238
    Tian Y, Wang H, Yuan F, Li N, Huang Q, He L, Wang L, Liu Z (2016) Perilla oil has similar protective efects of fsh oil on high-fat diet-induced nonalcoholic fatty liver disease and gut dysbiosis. Biomed Res Int 2016:1–11
    Tontonoz P, Hu E, Spiegelman BM (1994) Stimulation of adipogenesis in fbroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell 79:1147–1156 doi: 10.1016/0092-8674(94)90006-X
    Venkatachalam AB, Sawler DL, Wright JM (2013) Tissue-specifc transcriptional modulation of fatty acid-binding protein genes, fabp2, fabp3 and fabp6, by fatty acids and the peroxisome proliferator, clofbrate, in zebrafsh (Danio rerio). Gene 520:14–21 doi: 10.1016/j.gene.2013.02.034
    Wang WN, Zhou J, Peng W, Tian TT, Ying Z, Yuan L, Mai WJ, Wang AL (2009) Oxidative stress, DNA damage and antioxidant enzyme gene expression in the Pacifc white shrimp, Litopenaeus vannamei when exposed to acute pH stress. Comp Biochem Physiol C 150:428–435
    Wang X, Li Y, Hou C, Gao Y, Wang Y (2015) Physiological and molecular changes in large yellow croaker (Pseudosciaena crocea R.) with high-fat diet-induced fatty liver disease. Aquac Res 46:272–282 doi: 10.1111/are.12176
    Wu ZX, Feng X, Xie LL, Peng XY, Yuan J, Chen XX (2012) Efect of probiotic Bacillus subtilis Ch9 for grass carp, Ctenopharyngodon idella (Valenciennes, 1844), on growth performance, digestive enzyme activities and intestinal microflora. J Appl Ichthyol 28:721–727 doi: 10.1111/j.1439-0426.2012.01968.x
    Xin J, Zeng D, Wang H, Ni X, Yi D, Pan K, Jing B (2014) Preventing non-alcoholic fatty liver disease through Lactobacillus johnsonii BS15 by attenuating infammation and mitochondrial injury and improving gut environment in obese mice. Appl Microbiol Biot 98:6817–6829 doi: 10.1007/s00253-014-5752-1
    Xu JH, Qin J, Yan BL, Zhu M, Luo G (2011) Efects of dietary lipid levels on growth performance, feed utilization and fatty acid composition of juvenile Japanese seabass (Lateolabrax japonicus) reared in seawater. Aquac Int 19:79–89 doi: 10.1007/s10499-010-9342-7
    Xu RY, Wan YP, Fang QY, Lu W, Cai W (2012) Supplementation with probiotics modifes gut fora and attenuates liver fat accumulation in rat nonalcoholic fatty liver disease model. J Clin Biochem Nutr 50:72–77
    Yang SP, Wu ZH, Jian JC, Zhang XZ (2010) Efect of marine red yeast Rhodosporidium paludigenum on growth and antioxidant competence of Litopenaeus vannamei. Aquaculture 309:62–65 doi: 10.1016/j.aquaculture.2010.09.032
    Yoo SR, Kim YJ, Park DY, Jung UJ, Jeon SM, Ahn YT, Huh CS, McGregor R, Choi MS (2013) Probiotics L. plantarum and L. curvatus in combination alter hepatic lipid metabolism and suppress diet-induced obesity. Obesity 21:2571–2578 doi: 10.1002/oby.20428
    Yuan X, Liang XF, Liu L, Fang J, Li J, Li A, Cai W, Xue M, Wang J, Wang Q (2016) Fat deposition pattern and mechanism in response to dietary lipid levels in grass carp, Ctenopharyngodon idellus. Fish Physiol Biochem 42:1557–1569 doi: 10.1007/s10695-016-0240-4
    Zang L, Shimada Y, Tanaka T, Nishimura N (2015) Rhamnan sulphate from Monostroma nitidum attenuates hepatic steatosis by suppressing lipogenesis in a diet-induced obesity zebrafsh model. J Funct Foods 17:364–370 doi: 10.1016/j.jff.2015.05.041
    Zhang D, Yan Y, Tian H, Jiang G, Li X, Liu W (2018) Resveratrol supplementation improves lipid and glucose metabolism in high-fat diet-fed blunt snout bream. Fish Physiol Biochem 44:163–173 doi: 10.1007/s10695-017-0421-9
    Zokaeifar H, Balcazar JL, Saad CR, Kamarudin MS, Sijam K, Arshad A, Nejat N (2012) Efects of Bacillus subtilis on the growth performance, digestive enzymes, immune gene expression and disease resistance of white shrimp, Litopenaeus vannamei. Fish Shellfsh Immunol 33:683–689 doi: 10.1016/j.fsi.2012.05.027
    Zuenko VA, Laktionov KS, Pravdin IV, Kravtsova LZ, Ushakova NA (2017) Efect of Bacillus subtilis in feed probiotic on the digestion of fsh cultured in cages. J Ichthyol 57:152–157 doi: 10.1134/S0032945217010143
  • 加载中
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Figures(3) / Tables(4)

Article Metrics

Article views(795) PDF downloads(17) Cited by()

Related
Proportional views

Effects of Bacillus subtilis on hepatic lipid metabolism and oxidative stress response in grass carp (Ctenopharyngodon idellus) fed a high-fat diet

    Corresponding author: Zhixin Wu, wuzhixin@mail.hzau.edu.cn; wuzhixin229@163.com
  • 1. College of Fisheries, Huazhong Agricultural University, Wuhan 430070, China
  • 2. Hubei Engineering Technology Research Center for Aquatic Animal Disease Control and Prevention, Wuhan 430070, China
  • 3. Key Laboratory of Freshwater Animal Breeding, Ministry of Agriculture, Wuhan 430070, China
  • 4. Hubei Provincial Engineering Laboratory for Pond Aquaculture, Wuhan 430070, China

Abstract: Bacillus subtilis is widely used in aquaculture as a probiotic. However, few studies have been conducted to examine the efect of B. subtilis on liver lipid metabolism. A total of 135 healthy grass carp (50.24 ± 1.38 g) were randomly divided into three groups: control (Con), high-fat diet (HF), and high-fat diet + B. subtilis (HF + B. subtilis), and fed for 8 weeks. The results showed that compared with the HF group, the weight gain rate (WGR) signifcantly increased (P < 0.05) and the hepatic lipid content, serum low-density lipoprotein cholesterol (LDL-C), and aspartate aminotransferase (AST) decreased in the group supplemented with B. subtilis (P < 0.05). Moreover, the hepatic mRNA expression of fatty acid synthase (FAS) was signifcantly down-regulated and the carnitine palmitoyl transferases (CPT1α1a) were up-regulated in the HF + B. subtilis group compared to the HF group (P < 0.05), respectively. Additionally, in the HF + B. subtilis group, glutathione (GSH) signifcantly increased (P < 0.05), while hydrogen peroxide (H2O2) and malondialdehyde (MDA) contents signifcantly decreased compared to the HF group (P < 0.05). B. subtilis may reduce the hepatic lipid content by inhibiting its synthesis and promoting β-oxidation of fatty acids. B. subtilis may also alleviate dyslipidaemia and prevent oxidative damage in the liver caused by the high-fat diet of grass carp. Hence, dietary supplementation with B. subtilis shows promise as a therapeutic or preventive tool against fatty liver disease.

    HTML

Introduction
  • Grass carp is one of the most important freshwater species in China that can consume artifcial diets and water plants (Du et al. 2006; Kong et al. 2017b). Feeding carp a high-fat diet may lead to fatty liver disease in this species and adversely infuence aquaculture production of grass carp (Huang et al. 2018). The literature clearly shows that dietary lipids can bring protein sparing efect and enhance growth. However, high levels of dietary lipids may have a negative efect on fsh growth. A study by Du et al. (2005) showed a positive efect only when dietary lipids were below 4% and a negative efect was observed when dietary lipids were higher than 6% in the growth of grass carp. Furthermore, consumption of a high-fat diet may lead to unwanted hepatic fat deposition (Li et al. 2016; Wang et al. 2015), dyslipidemia (Sabzi et al. 2017; Zhang et al. 2018), afect the antioxidative system (Chen et al. 2016; Huang et al. 2018; Ma et al. 2018), and afect normal gut microbiota leading to dysbiosis (Al-Muzafar and Amin 2017; Falcinelli et al. 2017; Tian et al. 2016). The above-mentioned efects of consuming a high-fat diet may ultimately impact health and reduce fsh harvest yields. Given this, it is of vital importance to fnd solutions to alleviate the adverse efects of consuming a high-fat diet.

    Published studies have shown that probiotics can modify gut microbiota and signifcantly reduce the risk for fatty liver disease in mammals, improve liver function, and have signifcant therapeutic efects on fatty liver disease induced by high-fat diet (Al-Muzafar and Amin 2017; Awaisheh et al. 2013; Xu et al. 2012). Recently, two published studies showed that using the probiotic Lactobacillus rhamnosus as a feed additive could improve intestinal epithelium structures and induce transcriptional decrease of genes related to triglyceride and cholesterol metabolism, concomitantly decreasing the body triglyceride and cholesterol levels in zebrafsh induced by a high-fat diet (Falcinelli et al. 2015, 2017). B. subtilis, a gram-positive, sporeforming, non-pathogenic bacterium, is widely used in aquaculture as a probiotic (Ren et al. 2017). B. subtilis has been shown to have a positive impact on the size and structure of the microbial community in the intestinal chyme, on the activity of some digestive enzymes, and on the digestibility and weight gain of carp (Zuenko et al. 2017). It has also been shown to improve growth performance and disease resistance in shrimp by enhancing the immune response (Zokaeifar et al. 2012). Our studies also show that B. subtilis has a protective efect, specifcally on the intestines in grass carp. This protective efect is based on the following knowledge about B. subtilis. (1) B. subtilis can modulate intestinal microfora and improve digestive enzyme activity and growth performance of grass carp (Wu et al. 2012). (2) B. subtilis has a protective efect on the intestinal mucosal structure, which can reduce damage to the intestinal mucosal barrier, and decrease infammation in grass carp (Huang et al. 2017). (3) B. subtilis efectively protects fsh against oxidative stress damage (Tang et al. 2018). However, few studies examine the efect of B. subtilis on liver lipid metabolism at present.

    Based on the above rationale and results of our previous studies, we aimed to determine the impact of B. subtilis on liver lipid metabolism and oxidative stress of grass carp by evaluating growth performance and morphology, hepatic lipid accumulation and histochemistry, serum biochemical indicators, expression of genes involved in lipid metabolism, and oxidative stress indicators. Our fndings can inform solutions for reducing the risk of fatty liver disease in grass carp as well as provide a theoretical basis for the application of B. subtilis in aquaculture practice.

Results

    Efect of B. subtilis on growth performance and morphological parameters

  • Data on the growth performance and morphological parameters of grass carp are presented in Table 1. After 8 weeks, the SGR and WGR of grass carp in the two groups fed the high-fat diet signifcantly increased compared to those in the control group (P < 0.05). The grass carp in the HF+B. subtilis group showed the highest WGR (P < 0.05). Furthermore, the HF group and HF+B. subtilis group had a higher FI and lower FCR compared to the control group (P < 0.05). Lastly, no signifcant diference was observed in SR, CF, HSI, and VSI among all the experimental groups (P > 0.05).

    Item Con HF HF + B. subtilis
    SR 100.00 ± 0.00 100.00 ± 0.00 100.00 ± 0.00
    IBW 50.39 ±1.69 50.15 ± 1.44 50.19 ± 1.89
    FBW 83.78 ±1.92a 92.73 ± 3.22b 95.42 ± 1.85b
    WGR 66.30±2.14a 84.90 ± 1.80b 90.19 ± 3.56c
    SGR 0.91 ± 0.03a 1.10 ± 0.02b 1.15 ± 0.04b
    FI 69.27 ± 3.75a 77.65 ± 2.94b 79.32 ± 1.9b
    FCR 2.08 ± 0.14b 1.82 ± 0.05a 1.75 ± 0.04a
    CF 1.82 ± 0.12 1.93 ± 0.11 1.87 ± 0.14
    HSI 1.92 ±0.22 1.96 ± 0.27 1.90 ± 0.16
    VSI 9.1 ± 0.51 8.95 ± 0.92 9.03 ±0.73
    Values are the mean ±SE (n= 3 tanks on growth performance and feed intake, and n = 6 on morphological parameters). Values within the same row with diferent letters are signifcantly diferent (P < 0.05)
    SR survival rate (%)=100×(fnal fsh number)/(initial fsh number), IBW (g · fsh-1) initial mean body weight, FBW (g · fsh-1) fnal mean body weight, WGR weight gain rate (%)= (fnal mean body weight-initial mean body weight)/initial mean body weight, SGR special growth rate (% d-1) =100×(ln (fnal mean body weight)- ln (initial mean body weight))/days, FI (g · fsh-1) feed intake, FCR feed conversion rate =feed intake/weight gain, CF condition factor= 100%×(body weight, g)/(body length, cm)3, HSI hepatosomatic index = 100%×(liver weight)/(body weight), VSI viscera index =100% × (viscera weight)/(body weight)

    Table 1.  Efects of the diferent kinds of feed on growth performance, feed intake and morphological parameters

  • Efect of B. subtilis on hepatic lipid accumulation in grass carp

  • Results of oil-red O staining are presented in Fig. 1a. Lipids are red colored and nuclei are blue colored after staining with oil-red O. The images show that the amount and volume of lipid droplets stained by oil-red O were higher in the HF group than those in the Con group, but lower than the HF + B. subtilis group. The relative areas of lipid droplets stained with oil-red O (Fig. 1b) were consistent with the results of hepatic lipid accumulation. As shown in Fig. 1c, the hepatic lipid content of the HF + B. subtilis group was between the control group and HF group, and was significantly different from the control group and HF group (P < 0.05).

    Figure 1.  Efect of B. subtilis on hepatic lipid accumulation in grass carp: (a) efect of the B. subtilis diet and high-fat diet on histochemistry (oil-red O staining) (original magnifcation×400, bars 50 μm); (b) the relative areas of the lipid droplets in oil-red O stained grass carp were analyzed by Image-Pro Plus 6.0; (c) efect of the B. subtilis diet and high-fat diet on the lipid content in the liver of grass carp. Values are the mean± SE (n=6). Diferent letters indicate signifcant diferences among groups (P < 0.05)

  • Efect of B. subtilis on serum biochemistry indicators of grass carp

  • As shown in Table 2, analysis of key indicators for lipid metabolism showed that the serum CHO and LDL-C levels in the HF group significantly increased compared to the control group (P < 0.05). However, in the HF + B. subtilis group, the serum CHO and LDL-C levels decreased to nearly the same level as the control group (P > 0.05). Moreover, fish fed the high-fat diet with B. subtilis had lower serum AST than fish fed the high-fat diet (P < 0.05). There was no significant difference in the serum TG, HDL-C content, ALT, TP, and Alb among the control group, HF group, and HF + B. subtilis group (P > 0.05).

    Item Con HF HF + B. subtilis
    CHO (mmol·L-1) 5.94 ± 0.26a 6.71 ± 0.22b 6.08 ± 0.19ab
    TG (mmol·L-1) 5.57 ±0.34 5.68 ± 0.24 5.58 ± 0.24
    HDL-Cmmol·L-1) 2.23 ±0.07 2.50 ± 0.15 2.26 ± 0.11
    LDL-C(mmol·L-1) 2.63 ± 0.06a 2.98±0.13b 2.60 ± 0.10a
    TP (g·L-1) 23.52 ± 0.78 22.61 ± 0.97 24.17 ± 0.83
    Alb (g·L-1) 15.45 ± 0.51 14.73 ± 0.55 14.18 ± 0.49
    AST (U·L-1) 61.48 ± 2.24a 79.81 ± 4.26b 65.46 ± 2.97a
    ALT (U·L-1) 7.09 ±0.27 7.48 ± 0.22 7.31 ± 0.18
    Values are the mean ± SE (n=6). Values within the same row with diferent letters are signifcantly diferent (P < 0.05)
    CHO cholesterol, TG plasma total triglyceride, HDL-C high-density lipoprotein cholesterol, LDL-C low-density lipoprotein cholesterol, TP total protein, Alb albumin, AST aspartate aminotransferase, ALT alanine aminotransferase

    Table 2.  Efect of B. subtilis on serum biochemistry indicators

  • Efect of B. subtilis on the expression of genes associated with lipid metabolism

  • As shown in Fig. 2, the groups displayed diferences in relative mRNA expression of lipid metabolism genes and transcription factors. The L-FABP was signifcantly up-regulated in the HF group (P < 0.05) with no signifcant diference in the HF + B. subtilis group compared to the control group and HF group (P > 0.05), respectively. The FAS, ACCα, SCD, LPL, CPTIα1a, SREBP-1c, PPARγ and PPARα were signifcantly down-regulated after fsh were fed the highfat diet for 8 weeks (P < 0.05). Moreover, the expression of FAS was signifcantly down-regulated and the expression of CPTIα1a was signifcantly up-regulated in the HF + B. subtilis group compared with the HF group (P < 0.05). The expression of LPL and PPARα in the HF + B. subtilis group was regulated to nearly the same level as the control group (P > 0.05).

    Figure 2.  Efect of B. subtilis on lipid metabolism gene and transcription factor mRNA expression in liver of grass carp. Values are the mean±SE (n=6). Diferent letters indicate signifcant diferences among groups (P < 0.05)

  • Efect of B. subtilis on the MDA and H2O2 contents and activities of antioxidant enzymes

  • As shown in Fig. 3, in the HF + B. subtilis group, GSH showed a signifcant increase compared to the HF group (P < 0.05), and the T-AOC higher than the control group (P < 0.05). H2O2 and MDA levels in HF + B. subtilis group were lower than in the HF group (P < 0.05) with no signifcant diference in the control group.

    Figure 3.  Efect of B. subtilis on MDA and H2O2 content and activities of antioxidant enzymes in liver of grass carp. Values are the mean ±SE (n=6). Diferent letters indicate signifcant diferences among groups (P < 0.05)

Discussion
  • Our results show that feeding a high-fat diet to grass carp for 8 weeks signifcantly increased SGR, WGR, and FI. This fnding is similar to fndings from a study conducted in zebrafsh fed a high-fat diet (Shimada et al. 2015; Zang et al. 2015) but difers from the results of the study in Atlantic salmon, Japanese seabass, and Jade Perch (Hillestad et al.1998; Xu et al. 2011). The inconsistency across studies may be related to the diferent feed formula, FI, aquaculture environment, and the species of fsh. Many study authors have reported that some probiotics, such as commercial mixed-species probiotics (Standen et al. 2016), Lactobacillus acidophilus (Chelladurai et al. 2012), Saccharomyces cerevisiae (Abass et al. 2018), B. subtilis, and Lactobacillus rhamnosus (Munirasu et al. 2017), are conducive to increasing the growth performance of fsh. In the present study, we observed that administration of B. subtilis was also benefcial to body weight gain as evidenced by a signifcant increase on WGR with no signifcant diference on FI compared to the HF group. In addition, no signifcant diferences were noted for CF, HSI, and VSI among grass carp fed two dietary lipid levels, which is similar to the study results in meagre Argyrosomus regius with increased dietary lipid (Chatzifotis et al. 2010).

    Lipid content and histochemical analyses of the liver demonstrated that a high-fat diet caused hepatic lipid accumulation and dietary supplementation probiotic B. subtilis decreased the hepatic lipid content with one study showing that Lactobacillus rhamnosus could decrease the lipid content of zebrafsh (Falcinelli et al. 2015). Similar results were also observed in juvenile Senegalese sole (Solea senegalensis, Kaup 1858) receiving a diet containing probiotic Shewanella spp. strains Pdp11 and Pdp13 signifcantly decreased numbers of lipid droplets in the liver and modulated the sole intestinal microbiota. This regulation of intestinal fora was mainly manifested as the increased presence of Shewanella spp. members and the decreased presence of Vibrio spp. members in the microbiota (Banda et al. 2010; Tapia-Paniagua et al. 2014). In our experiments, we only measured the hepatic lipid content of grass carp supplemented with B. subtilis. The change of intestinal fora after B. subtilis treatment will be a measurement in our follow-up study. Additionally, this observation was also similar to results of treating mammals with fatty liver disease induced by high-fat diet with probiotics (Lee et al. 2006; Ma et al. 2008; Xu et al. 2012).

    Once fatty acids enter the liver, they are esterifed into TG and then can be stored into the hepatocytes in lipid droplets or enter the blood through TG-rich lipoproteins (Yuan et al. 2016), which can lead to a signifcant change in CHO and TG in blood (Jung et al. 2013; Rincon-Cervera et al. 2016). Therefore, serum lipid metabolism-related indicators, such as CHO, TG, HDL-C and LDL-C, were evaluated. Our data showed that the content of CHO in the HF group was higher than those of the other two groups. In addition, compared with the HF group, adding B. subtilis to the high-fat diet resulted in a decreased LDL-C content. Similar studies confrmed that intestinal probiotics are benefcial for lowering CHO levels in rats (Awaisheh et al. 2013) and treatment with Bifdobacterium spp. decreased LDL-C in serum in high-fat diet-induced obese rats (An et al. 2011). This suggests that B. subtilis supplementation alleviates dyslipidaemia, which corresponds to results that B. subtilis could reduce liver lipid contents in our study. AST and ALT are the best clinical biomarkers of hepatic functions and are mainly distributed in the mitochondria and cytoplasmic water-soluble phase, respectively. Once the liver cells are damaged, a large amount of AST and ALT will enter into the extracellular space and ultimately into circulation (Ozer et al. 2008). Hassaan et al. (2018) observed a signifcant decrease in AST and ALT in Nile tilapia (Oreochromis nilotcus) fed a diet containing B. subtilis. We found that the AST in serum decreased in the HF + B. subtilis group, similar to results observed with specifc probiotic strains in fatty liver disease of mice and rats induced by a high-fat diet (Al-Muzafar and Amin 2017; Xin et al. 2014).

    To explore the molecular mechanisms involved in B. subtilis regulation of lipid deposition, the expression of several key genes in the liver was analyzed. We frst examined the mRNA expression of L-FABP, which is related to fatty acid transport. L-FABP is a type of fatty acid binding protein that transports lipids to lipid droplets for storage and to mitochondria for β-oxidation (Schroeder et al. 1998; Venkatachalam et al. 2013). Briskey (2015) observed that probiotics restored expression of L-FABP gene to a level similar to that in mice fed with a chow diet, which was similar to our results. The main lipogenic enzymes, such as FAS, ACC, and SCD1 (Chen et al. 2013; Song et al. 2016), and important lipogenic factors, such as SREBP-1c and PPARγ, can regulate hepatic fatty acid synthesis, which in turn, drives hepatic triglyceride synthesis (Eberle et al. 2004; Rosen et al. 1999; Tontonoz et al. 1994). PPARα regulates lipid catabolism by inducing the expression of CPT (Ji et al. 2011; Kerner and Hoppel 2000; Morash et al. 2008). Our results showed that the high-fat diet caused downregulation of both the enzymes involved in fatty acid synthesis (FAS, ACCα, SCD) and transcription factors (PPARγ and SREBP-1c). The down-regulation of these mRNA expressions is a form of adaption of grass carp to a high-fat diet to achieve a dynamic balance between endogenous fatty acids and exogenous fatty acids (Li et al. 2016). Down-regulated CPTIα1a mRNA expression suggests that the high-fat diet caused the synthesis and β-oxidation of fatty acids to be reduced. B. subtilis down-regulated FAS mRNA expression and up-regulated CPTIα1a mRNA expression, indicating that adding B. subtilis to the diet may decrease the hepatic lipid content by inhibiting the synthesis and promoting the β-oxidation of fatty acids, which is consistent with the result of serum CHO and LDL-C content. Studies by Briskey (2015) and Yoo et al. (2013) showed results similar to ours.

    Oxidative stress and altered redox balance play an important role in the pathogenesis of steatosis (Roberto et al. 2011). SOD, CAT, and GSH are important antioxidant enzymes that play an important role in protecting cells from oxidative stress and preventing or repairing oxidative damage. For example, the dismutation of two superoxide radicals to H2O2 was shown to be catalyzed by SOD, whereas H2O2 was degraded by CAT (Wang et al. 2009). MDA is a product of lipid oxidative damage and it is used to evaluate lipid peroxidation (Tang et al. 2018; Yang et al. 2010). Our experimental results showed that after feeding grass carp the diet containing B. subtilis, their antioxidant capacity was signifcantly improved and the oxidative stress response was also reduced, which was mainly refected in the signifcant improvement of liver GSH, the lower content of MDA and H2O2 compared with HF group and the higher T-AOC compared with control group. The supplementation of B. subtilis in the diet after 40 days could signifcantly increase the activity of T-AOC and SOD and signifcantly decrease the MDA levels in the serum of Litopenaeus vannamei (Shen et al. 2010). After feeding the basic diet containing B. subtilis for 4 weeks, the activity of T-AOC, SOD, CAT and GSH was signifcantly increased and the content of MDA was signifcantly decreased in the liver of grass carp (Li et al. 2012). These results are similar to ours. Consequently, B. subtilis efectively enhanced the antioxidant capacity and improved oxidative damage of grass crap fed a high-fat diet.

Conclusions
  • In conclusion, the present study demonstrated that a high-fat diet intake induced hepatic lipid accumulation, but dietary supplementation of probiotic B. subtilis may inhibit the synthesis and promote the β-oxidation of fatty acids in the liver to signifcantly reduce hepatic lipid accumulation, alleviate dyslipidaemia and liver oxidative damage in grass carp, which contribute to the amelioration of diet-induced fatty liver disease progress. Additionally, B. subtilis promotes the growth performance of grass carp, which has a certain guiding signifcance for aquaculture production.

Materials and methods

    Bacterial strains

  • The bacteria used in this study were isolated from the gut of grass carp. The isolated bacterial strain was identifed as B. subtilis Ch9 and stored in the Laboratory of Aquatic Animal Medicine, Fisheries College of Huazhong Agricultural University. B. subtilis was inoculated onto a Luria–Bertani (LB) agar plate, then incubated for 24 h at 37 ℃. A single clone was selected and inoculated into LB broth and cultured in a shaker at 37 ℃ for 3 days. Bacterial cells were harvested by centrifugation at 3500 rpm for 15 min. The supernatant was discarded. The pellet was re-suspended in sterile phosphate-bufered saline (PBS) to remove metabolic waste from the bacterial solution. It was then diluted.

  • Diet preparation

  • Three diets were prepared and used in this study control (basal) diet (4% lipids of the dry matter), high-fat diet (8% lipids of the dry matter), and high-fat diet supplemented with B. subtilis (8% lipids of the dry matter). The composition and chemical analyses of the three diets are presented in Table 3. All ingredients were purchased from Hubei Haida Feed Co., Ltd. (Wuhan, China). After ingredients were thoroughly mixed (including B. subtilis solution), pellets with a diameter of 2 mm were produced by a granulator in 30 min. After the pellets were air dried, they were stored in a freezer at - 20 ℃ until use. Before use, the survival of B. subtilis was 1 × 107 CFU g-1 as determined by the plate counting method.

    Experimental diets Basal diet High-fat diet High-fat diet + B. subtilis
    Ingredients (g·kg-1)
      Fish meal 80 80 80
      Soybean meal 240 240 240
      Rapeseed meal 340 340 340
      Wheat flour 250 250 250
      Soybean oil 6 46 46
      Ca(H2PO4)2 20 20 20
      Vitamin premixa 1 1 1
      Mineral premixb 3 3 3
      NaCl 2 2 2
      Choline chloride 2 2 2
      Sodium carboxymethyl cellulose 56 16 16
      Total 1000 1000 1000
    Proximate composition
      Crude protein (% DM) 29.83 29.66 29.61
      Crude lipid (% DM) 4.39 8.27 8.29
      Moisture (% DM) 10.16 9.95 9.93
      Ash (% DM) 8.32 8.12 8.17
    aVitamin premix (mg·kg-1): vitamin A 6500 IU, vitamin D3 4500 IU, vitamin C 120 mg, vitamin E 25 mg, vitamin K3 5 mg, vitamin B1 12.5 mg, vitamin B2 12.5 mg, vitamin B6 15.0 mg, vitamin B12 0.025 mg, niacinamide 50 mg, pantothenate 40 mg, inositol 75 mg, folic acid 2.5 mg, biotin 0.08 mg
    bMineral premix (mg·kg-1): NaCl 1.0, MgSO4 15.0, NaH2PO4·2H2O 25.0, AlCl3·6H2O 0.06, KH2PO4 32.0, Ca(H2PO4)2·H2O 20.0, C6H5FeO7·10H2O 2.5, CaC6H10CaO6·5H2O 3.5, ZnSO4·7H2O 0.353, MnSO4·4H2O 0.162, CuSO4·5H2O 0.031, CoCl2·6H2O 0.001, KIO3·6H2O, 0.003, cellulose, 0.39

    Table 3.  Compositions of diets

  • Experimental procedures

  • Grass carp were obtained from a commercial freshwater fsh farm (Bai Rong Aquaculture Co., Ltd., Hubei Province) and reared in circular polyester tanks. After 2 weeks, 135 healthy grass carp (50.24 ± 1.38) g were randomly divided into one of the three groups: control (fed a basal diet), HF (fed a high-fat diet), and HF + B. subtilis (fed a high-fat diet supplemented with B. subtilis), with each group in three replicate tanks with a capacity of 300 L (15 fsh per tank). All grass carp were fed to apparent satiation twice daily (08:30 and 16:30) for 8 weeks. During the entire experimental period, one-third of the water was replaced daily. The recirculating water temperature was maintained at (25 ± 1) ℃, pH at 7.5 ± 0.3, dissolved oxygen at (7 ± 0.45) mg·L-1, ammonia at (0.015 ± 0.002) mg·L-1 and nitrate at (0.05 ± 0.008) mg·L-1.

  • Sampling for analyses

  • At the end of the 8-week feeding trial, approximately 24 h after the last feeding, the survival rate and body weight gain of fsh in every tank were calculated. A total of 24 fsh per group were then randomly selected and euthanized (MS-222, 10 mg·L-1). Six fsh were measured for their individual body length and body weight to calculate the condition factor (CF). Blood samples were collected from the caudal vein before dissection to measure serum biochemical indicators. The fsh were then dissected on ice. The liver weight and visceral mass weight were measured to calculate the hepatosomatic index (HSI) and viscera index (VSI). Six fsh were immediately removed using sterile forceps, frozen in liquid nitrogen and stored at - 80 ℃ (not longer than 2 weeks) for total RNA extraction and antioxidant activities, six fsh for determination of liver lipid content, and another six fsh for histochemical observation.

  • Hepatic lipid

  • Live samples were freeze dried for 24 h at - 50 ℃ to obtain the dried liver sample. The crude lipid content of individual samples was determined using Soxhlet extraction.

  • Histochemical observation

  • Histochemical analysis was performed as described by Song et al. (2016) with slight modifcations. Briefy, histochemical observations were carried out by oil-red O staining. First, the liver samples were fxed with paraformaldehyde, dehydrated with sucrose, embedded in optimal cutting temperature compound (OCT), sliced (thickness 8 μm) using a cryostat microtome, and stained with oil-red O. Photos were then taken under a microscope (400 ×). Ten felds of view were randomly selected from each sample to calculate the relative area of lipid droplets in oil-red-O stained liver tissue.

  • Serum biochemical analysis

  • The CHO, TG, HDL-C, LDL-C, Alb, TP, AST, and ALT contents were determined using an automatic biochemical analyser (Selectra-xl, the Netherlands) at the Fisheries College of Huazhong Agricultural University (Wuhan, Hubei, China). All kits were purchased from Biosino Bio-Technology and Science, Inc.

  • Real-time polymerase chain reaction analysis

  • TriPure Reagent Kit (Aidlab, RN0102) was used according to its instructions to extract RNA from the liver tissue of grass carp. The quality and quantity of RNA were then assessed via agarose gel (1%) electrophoresis and spectrophotometric (A260:280 nm ratio) analysis, respectively. RNA was reverse transcribed into cDNA using a TRUE script 1st Strand cDNA Synthesis Kit with gDNA Eraser (Aidlab, PC5402). β-Actin is a commonly used reference gene to normalize cDNA loading in grass carp in our laboratory (Kong et al. 2017a, b; Tang et al. 2018) and was used in this study. Specifc primers were designed according to the published sequences of grass carp and are presented in Table 4. Real-time quantitative PCR was performed on a Roche LightCycler 480 real-time PCR instrument. The total volume of the reaction was 20 μL and included 2 μL cDNA, 0.5 μL each primer, 7 μL aqueous diethylpyrocarbonate (DEPC), and 10 μL 2 × SYBR Green qPCR Mix (Aidlab, PC5902). The relative mRNA expression levels were calculated using the 2-ΔΔCt method.

    Gene GenBank accession no. Primers Sequence (5' to 3') Annealing tempera- ture
    L-FABP EU220990.1 L-FABP-F GGGAAAACCATCACTAACTC 58 ℃
    L-FABP-R TCAGGGTCTCAACCATCTC
    FAS HM802556.1 FAS -F GTCCACAGGGTGTCGTTC 58 ℃
    FAS -R GAGGTCTTGGGCTCTTTATT
    ACCα GU908475 ACCα-F AGTATCGCAGTGGCATCA 58 ℃
    ACCα-R TGTCCCCTTTGTTTTCCT
    SCD AJ243835 SCD-F GTTTGTGCCCTGGTTCTT 58 ℃
    SCD-R GGGGTTAATGGTGCTGTC
    LPL FJ436077 LPL-F AGCCCTGTATGAACGAGA 58 ℃
    LPL-R CACATCCTTGCCCACTAG
    CPTIα1a KJ816747 CPTIα1a-F TTTACGACGGACGGTTGC 58 ℃
    CPTIα1a-R GCTTGTTCTTCCCACGACT
    SREBP-1c GU339498 SREBP-1c-F GGATTGAGGTGAGCCGACAT 58 ℃
    SREBP-1c-R TGAGGAAAGCCATTGACTACATT
    PPARγ GQ220296 PPARy-F AATGCACCTTTCGTTATCC 58 ℃
    PPARy-R GAGCGTCACTTGGTCGTTC
    PPARα FJ595500 PPARa-F TGTCAATACTGCCGTTTCC 58 ℃
    PPARa-R GACTGGTGCTCCTCTTTCC
    β-actin M25013 β-actin-F CCTTCTTGGGTATGGAGTCTTG T
    β-actin-R AGAGTATTTACGCTCAGGTGGG
    L-FABP liver-type fatty acid-binding protein, FAS fatty acid synthase, ACCα acetyl-CoA carboxylase alpha, SCD stearoyl-CoA desaturase, LPL lipoprotein lipase, CPTIα1a carnitine palmitoyl transferases, SREBP-1c sterol-regulatory element binding proteins, PPARγ peroxisome proliferator activated receptor gamma, PPARα peroxisome proliferator activated receptor alpha, β-actin beta-actin

    Table 4.  Primers used for real-time PCR analysis

  • Oxidative stress in liver

  • The total antioxidant capacity (T-AOC), the malondialdehyde (MDA) and hydrogen peroxide (H2O2) concentration, the superoxide dismutase (SOD) and catalase (CAT) activity, and glutathione (GSH) levels were determined using commercial kits provided by Nanjing Jiancheng Bioengineering Institute (China). Kits were used according to manufacturer instructions.

  • Statistical analyses

  • One-way analysis of variance was used to analyze the data. All results are expressed as the mean ± SE (standard error of the mean). Multiple comparisons were performed using the Duncan multiple range test among the groups. Statistical signifcance was P < 0.05. All statistical analyses were performed using SPSS 22.0.

Acknowledgements
  • This work was supported by the National Natural Science Foundation of China (Grant nos. 31472310 and 31672683) and the Technical Innovation Project of Hubei Province (Grant No. 2018ABA103).

Author contributions
  • Conceptualization, HZ and YL; methodology, HZ, YL, YZ, XC, HW, DG and ZW; validation, HZ and YL; writingoriginal draft preparation, HZ and YL; writing-review and editing, XC and ZW; supervision, ZW; project administration, ZW.

Compliance with ethical standards

    Conflict of interest

  • The authors declare that there are no conficts of interest.

  • Ethics statement

  • All applicable international, national, and institutional guidelines for the care and use of animals were followed by the authors.

Reference (60)

Catalog

/

DownLoad:  Full-Size Img  PowerPoint
Return
Return